Incidental Mutation 'R4822:Dnhd1'
ID371213
Institutional Source Beutler Lab
Gene Symbol Dnhd1
Ensembl Gene ENSMUSG00000030882
Gene Namedynein heavy chain domain 1
Synonyms8030491N06Rik
MMRRC Submission 042438-MU
Accession Numbers

Variant 1:ENSMUST00000145988; OTTMUST00000062891; Variant 2:  ENSMUST00000106773; Variant 3: ENSMUST00000106776; Variant 4: ENSMUST00000163171; Variant 5: ENSMUST00000142363;OTTMUST00000062869; Variant 6: ENSMUST00000142874; OTTMUST00000062870; Variant 7: ENSMUST00000128388; OTTMUST00000062892; MGI:1924755

Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R4822 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location105650827-105721799 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105703964 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 2775 (D2775N)
Ref Sequence ENSEMBL: ENSMUSP00000121261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000145988]
Predicted Effect probably benign
Transcript: ENSMUST00000145988
AA Change: D2775N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121261
Gene: ENSMUSG00000030882
AA Change: D2775N

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
low complexity region 183 191 N/A INTRINSIC
low complexity region 253 269 N/A INTRINSIC
low complexity region 943 962 N/A INTRINSIC
Pfam:DHC_N2 1018 1472 4.6e-50 PFAM
Pfam:AAA_6 1652 1875 2.7e-14 PFAM
low complexity region 1906 1918 N/A INTRINSIC
Blast:AAA 1993 2196 1e-34 BLAST
Pfam:AAA_7 2362 2610 3.3e-11 PFAM
low complexity region 2697 2714 N/A INTRINSIC
low complexity region 2722 2733 N/A INTRINSIC
low complexity region 2800 2810 N/A INTRINSIC
low complexity region 3116 3134 N/A INTRINSIC
Pfam:MT 3178 3470 3.9e-16 PFAM
coiled coil region 3590 3642 N/A INTRINSIC
coiled coil region 3816 3843 N/A INTRINSIC
Pfam:Dynein_heavy 3976 4746 7.3e-97 PFAM
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (101/103)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik C T 14: 70,156,458 V243I probably benign Het
Acadvl C T 11: 70,011,184 G485S probably benign Het
Acap3 T A 4: 155,902,451 probably benign Het
Adamts19 A G 18: 58,890,284 I250M probably damaging Het
AF067061 A T 13: 120,264,150 T117S probably damaging Het
Amacr T A 15: 10,983,410 I102N probably damaging Het
Apob A G 12: 8,015,741 T4237A probably benign Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Bicd1 A T 6: 149,519,254 probably benign Het
Caskin2 T A 11: 115,807,299 E49V probably damaging Het
Cemip T A 7: 83,973,241 I577F probably benign Het
Chrnb1 T C 11: 69,795,675 S40G possibly damaging Het
Ctif C T 18: 75,521,561 C298Y probably benign Het
Cul9 A C 17: 46,530,051 H764Q probably benign Het
Cwf19l2 T A 9: 3,458,839 C763S probably damaging Het
Dhx57 A T 17: 80,242,167 probably null Het
Enpp1 A T 10: 24,661,935 M384K possibly damaging Het
Fat2 T C 11: 55,311,318 N310S probably benign Het
Fbxw7 A T 3: 84,967,507 Y232F possibly damaging Het
Fcamr T A 1: 130,812,686 S281T possibly damaging Het
Gm10762 C T 2: 128,967,186 W81* probably null Het
Gm5592 A G 7: 41,155,890 probably benign Het
Gm5745 T C 9: 73,175,698 noncoding transcript Het
Gm6185 G C 1: 161,213,254 noncoding transcript Het
Hid1 T A 11: 115,355,299 N382Y probably damaging Het
Hoxa10 A T 6: 52,232,589 F68I probably damaging Het
Ift88 T A 14: 57,441,869 probably null Het
Ighg2b A T 12: 113,306,391 *336R probably null Het
Ighv7-2 A C 12: 113,912,272 L37R probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnn3 G C 3: 89,667,289 V703L possibly damaging Het
Kiz C A 2: 146,891,069 S388R probably damaging Het
Klhl20 G A 1: 161,093,763 Q41* probably null Het
Krt31 T C 11: 100,047,784 I328V possibly damaging Het
Lama4 A T 10: 39,033,053 I330L probably benign Het
Lipo2 A T 19: 33,745,751 S213T probably benign Het
Lrsam1 A T 2: 32,926,792 I723N probably damaging Het
Man2b2 G A 5: 36,815,521 R550W probably damaging Het
Map4k5 A T 12: 69,841,984 L224* probably null Het
Mast3 A G 8: 70,780,366 S1101P probably damaging Het
Mertk A G 2: 128,801,305 S875G probably benign Het
Mmel1 A G 4: 154,887,897 M302V probably benign Het
Mrgpra3 T A 7: 47,589,968 H70L possibly damaging Het
Myh3 T A 11: 67,089,010 S592T probably benign Het
Nbeal2 T C 9: 110,636,315 I451V possibly damaging Het
Nup155 T A 15: 8,128,526 V489D possibly damaging Het
Obscn T A 11: 59,022,333 T6300S probably benign Het
Olfr1294 G T 2: 111,537,452 T279K probably damaging Het
Olfr1377 T A 11: 50,985,083 C127* probably null Het
Olfr290 A C 7: 84,916,426 I216L possibly damaging Het
Olfr350 A G 2: 36,850,876 M277V probably benign Het
Oprm1 A G 10: 6,829,036 I146V probably damaging Het
Otub1 A T 19: 7,204,429 D27E probably damaging Het
Pik3ca T C 3: 32,437,982 V243A probably benign Het
Pla2g12b G A 10: 59,416,514 probably null Het
Plekha8 A G 6: 54,624,561 D321G probably damaging Het
Pprc1 T C 19: 46,071,356 probably benign Het
Prkdc A G 16: 15,650,712 D129G possibly damaging Het
Rbms3 C T 9: 116,944,373 probably benign Het
Rictor T A 15: 6,791,680 V1495D probably benign Het
Rpl31-ps21 T C 5: 21,119,509 noncoding transcript Het
Ryr3 A T 2: 112,652,745 I4219N probably damaging Het
Sbf2 G A 7: 110,377,939 probably benign Het
Scn10a C T 9: 119,638,672 A801T probably damaging Het
Scn9a T A 2: 66,483,749 Y1866F possibly damaging Het
Sec1 A C 7: 45,679,303 Y107D probably damaging Het
Sema6d C T 2: 124,662,294 T619M possibly damaging Het
Sh2b3 C A 5: 121,828,555 probably benign Het
Slc2a4 A G 11: 69,946,587 V44A probably damaging Het
Slc5a12 T C 2: 110,621,740 I326T possibly damaging Het
Smarca5 T C 8: 80,708,680 probably null Het
Smarcd2 A G 11: 106,266,531 probably null Het
Snrpa1 A T 7: 66,069,573 probably benign Het
Sptbn5 T G 2: 120,067,968 K470Q probably benign Het
Stard9 T G 2: 120,695,941 V893G possibly damaging Het
Stx8 T G 11: 67,973,273 V53G possibly damaging Het
Sv2c A T 13: 95,985,949 W440R probably damaging Het
Tmem181a A T 17: 6,280,665 I67F probably benign Het
Tmprss7 C T 16: 45,663,316 C565Y probably damaging Het
Trafd1 A T 5: 121,378,498 L109H probably damaging Het
Trpv4 A G 5: 114,630,022 I422T possibly damaging Het
Usp24 T A 4: 106,416,047 Y2210N probably damaging Het
Vmn1r236 A T 17: 21,286,940 N107Y probably damaging Het
Vmn2r13 A T 5: 109,174,072 I253K probably damaging Het
Vmn2r2 T A 3: 64,134,539 I252F probably damaging Het
Vsig8 A G 1: 172,559,638 D27G probably damaging Het
Wdr92 T A 11: 17,227,165 N174K probably damaging Het
Wiz A T 17: 32,356,437 Y908* probably null Het
Wnk1 A T 6: 119,962,438 S1113T probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp691 G T 4: 119,170,567 T156K probably damaging Het
Zfp791 A T 8: 85,110,406 D276E probably benign Het
Other mutations in Dnhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Dnhd1 APN 7 105677995 missense probably damaging 1.00
IGL00516:Dnhd1 APN 7 105657211 missense possibly damaging 0.52
IGL00576:Dnhd1 APN 7 105692675 missense probably damaging 1.00
IGL00990:Dnhd1 APN 7 105721688 missense possibly damaging 0.85
IGL01346:Dnhd1 APN 7 105713909 missense probably benign
IGL01714:Dnhd1 APN 7 105720942 missense probably damaging 1.00
IGL01735:Dnhd1 APN 7 105713754 missense probably benign 0.37
IGL01814:Dnhd1 APN 7 105652030 missense probably benign
IGL01999:Dnhd1 APN 7 105721215 missense possibly damaging 0.50
IGL02022:Dnhd1 APN 7 105678309 missense probably damaging 1.00
IGL02131:Dnhd1 APN 7 105720802 missense probably damaging 1.00
IGL02156:Dnhd1 APN 7 105721744 missense probably damaging 1.00
IGL02674:Dnhd1 APN 7 105721481 missense probably benign 0.00
IGL02966:Dnhd1 APN 7 105720741 missense probably benign 0.00
IGL03066:Dnhd1 APN 7 105719882 missense probably damaging 0.99
IGL03298:Dnhd1 APN 7 105714475 missense probably damaging 0.98
IGL03378:Dnhd1 APN 7 105713733 missense possibly damaging 0.87
IGL02802:Dnhd1 UTSW 7 105655723 missense possibly damaging 0.83
R0060:Dnhd1 UTSW 7 105668514 missense probably damaging 0.99
R0129:Dnhd1 UTSW 7 105720924 missense probably benign 0.19
R0238:Dnhd1 UTSW 7 105721531 missense probably benign 0.06
R0238:Dnhd1 UTSW 7 105721531 missense probably benign 0.06
R0239:Dnhd1 UTSW 7 105721531 missense probably benign 0.06
R0239:Dnhd1 UTSW 7 105721531 missense probably benign 0.06
R0384:Dnhd1 UTSW 7 105720114 missense possibly damaging 0.56
R0453:Dnhd1 UTSW 7 105674444 missense probably benign 0.00
R0540:Dnhd1 UTSW 7 105720788 missense probably benign 0.04
R0554:Dnhd1 UTSW 7 105694395 missense probably benign 0.10
R0576:Dnhd1 UTSW 7 105714045 missense probably damaging 1.00
R0607:Dnhd1 UTSW 7 105720788 missense probably benign 0.04
R0631:Dnhd1 UTSW 7 105651624 missense probably benign 0.17
R0639:Dnhd1 UTSW 7 105696464 missense possibly damaging 0.95
R0668:Dnhd1 UTSW 7 105695751 missense probably benign
R0669:Dnhd1 UTSW 7 105693704 missense probably benign 0.01
R0670:Dnhd1 UTSW 7 105696464 missense possibly damaging 0.95
R0699:Dnhd1 UTSW 7 105651906 missense probably damaging 0.98
R1019:Dnhd1 UTSW 7 105709171 missense probably damaging 1.00
R1144:Dnhd1 UTSW 7 105713031 missense probably damaging 1.00
R1226:Dnhd1 UTSW 7 105696899 missense probably damaging 1.00
R1257:Dnhd1 UTSW 7 105694153 missense probably damaging 1.00
R1391:Dnhd1 UTSW 7 105720124 missense probably damaging 1.00
R1453:Dnhd1 UTSW 7 105721273 critical splice donor site probably null
R1501:Dnhd1 UTSW 7 105668463 missense probably benign 0.00
R1503:Dnhd1 UTSW 7 105693660 missense possibly damaging 0.67
R1515:Dnhd1 UTSW 7 105704148 missense probably benign 0.11
R1615:Dnhd1 UTSW 7 105703206 missense probably benign 0.00
R1615:Dnhd1 UTSW 7 105713706 missense possibly damaging 0.74
R1656:Dnhd1 UTSW 7 105714281 missense probably damaging 1.00
R1720:Dnhd1 UTSW 7 105693828 missense probably benign
R1723:Dnhd1 UTSW 7 105714920 missense possibly damaging 0.60
R1766:Dnhd1 UTSW 7 105693972 missense possibly damaging 0.50
R1799:Dnhd1 UTSW 7 105655767 missense probably benign 0.31
R1860:Dnhd1 UTSW 7 105704205 missense probably benign
R1920:Dnhd1 UTSW 7 105713407 missense probably benign 0.00
R1925:Dnhd1 UTSW 7 105652252 missense probably damaging 1.00
R1925:Dnhd1 UTSW 7 105673854 missense probably damaging 0.96
R1934:Dnhd1 UTSW 7 105708582 missense probably benign 0.05
R1935:Dnhd1 UTSW 7 105673976 missense probably benign 0.09
R1936:Dnhd1 UTSW 7 105673976 missense probably benign 0.09
R2035:Dnhd1 UTSW 7 105704921 missense probably damaging 0.99
R2125:Dnhd1 UTSW 7 105677971 missense probably benign 0.35
R2127:Dnhd1 UTSW 7 105693721 missense possibly damaging 0.56
R2254:Dnhd1 UTSW 7 105703772 missense probably damaging 1.00
R2301:Dnhd1 UTSW 7 105705399 missense probably damaging 1.00
R2316:Dnhd1 UTSW 7 105674421 missense probably damaging 1.00
R2324:Dnhd1 UTSW 7 105710090 missense probably damaging 1.00
R2337:Dnhd1 UTSW 7 105703467 missense probably benign 0.07
R2381:Dnhd1 UTSW 7 105693664 missense probably benign 0.42
R2394:Dnhd1 UTSW 7 105720231 missense probably benign 0.19
R2862:Dnhd1 UTSW 7 105712559 missense probably benign 0.01
R3038:Dnhd1 UTSW 7 105720229 missense probably damaging 0.99
R3114:Dnhd1 UTSW 7 105696565 critical splice donor site probably null
R3404:Dnhd1 UTSW 7 105694761 nonsense probably null
R3405:Dnhd1 UTSW 7 105694761 nonsense probably null
R3439:Dnhd1 UTSW 7 105694785 missense probably damaging 1.00
R3959:Dnhd1 UTSW 7 105713122 missense probably benign 0.21
R4014:Dnhd1 UTSW 7 105714838 missense probably damaging 0.99
R4084:Dnhd1 UTSW 7 105709588 missense probably damaging 1.00
R4181:Dnhd1 UTSW 7 105693954 missense probably damaging 1.00
R4255:Dnhd1 UTSW 7 105712998 missense probably damaging 1.00
R4302:Dnhd1 UTSW 7 105693954 missense probably damaging 1.00
R4440:Dnhd1 UTSW 7 105696728 nonsense probably null
R4565:Dnhd1 UTSW 7 105651956 missense possibly damaging 0.92
R4569:Dnhd1 UTSW 7 105657166 splice site probably null
R4584:Dnhd1 UTSW 7 105678049 missense probably damaging 1.00
R4586:Dnhd1 UTSW 7 105678049 missense probably damaging 1.00
R4590:Dnhd1 UTSW 7 105714030 missense probably damaging 1.00
R4593:Dnhd1 UTSW 7 105715446 missense probably benign 0.02
R4600:Dnhd1 UTSW 7 105703644 missense probably damaging 1.00
R4705:Dnhd1 UTSW 7 105655741 missense probably damaging 1.00
R4731:Dnhd1 UTSW 7 105673849 missense probably benign 0.00
R4732:Dnhd1 UTSW 7 105673849 missense probably benign 0.00
R4733:Dnhd1 UTSW 7 105673849 missense probably benign 0.00
R4786:Dnhd1 UTSW 7 105674444 missense probably benign 0.00
R4791:Dnhd1 UTSW 7 105721117 missense probably damaging 1.00
R4811:Dnhd1 UTSW 7 105714281 missense probably damaging 0.99
R4886:Dnhd1 UTSW 7 105714808 missense probably benign 0.00
R4890:Dnhd1 UTSW 7 105656957 missense possibly damaging 0.47
R4973:Dnhd1 UTSW 7 105713633 missense probably benign 0.24
R5007:Dnhd1 UTSW 7 105713076 missense probably damaging 1.00
R5048:Dnhd1 UTSW 7 105693697 missense probably benign 0.01
R5151:Dnhd1 UTSW 7 105713440 missense probably benign 0.22
R5179:Dnhd1 UTSW 7 105714552 missense probably damaging 1.00
R5182:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5183:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5185:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5209:Dnhd1 UTSW 7 105696460 missense probably benign 0.00
R5225:Dnhd1 UTSW 7 105703923 missense possibly damaging 0.73
R5250:Dnhd1 UTSW 7 105685761 missense probably damaging 1.00
R5257:Dnhd1 UTSW 7 105674037 missense probably benign
R5258:Dnhd1 UTSW 7 105674037 missense probably benign
R5273:Dnhd1 UTSW 7 105714482 missense probably damaging 0.99
R5288:Dnhd1 UTSW 7 105714437 missense possibly damaging 0.94
R5396:Dnhd1 UTSW 7 105713684 missense probably benign 0.00
R5453:Dnhd1 UTSW 7 105710123 missense probably damaging 1.00
R5511:Dnhd1 UTSW 7 105714156 missense probably damaging 1.00
R5518:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5523:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5528:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5529:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5561:Dnhd1 UTSW 7 105714821 missense probably damaging 0.99
R5681:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5682:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5683:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5684:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5686:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5697:Dnhd1 UTSW 7 105674188 missense probably damaging 1.00
R5789:Dnhd1 UTSW 7 105705010 missense possibly damaging 0.50
R5790:Dnhd1 UTSW 7 105655774 missense probably damaging 1.00
R5814:Dnhd1 UTSW 7 105719895 missense possibly damaging 0.69
R5828:Dnhd1 UTSW 7 105720181 missense probably benign 0.00
R5852:Dnhd1 UTSW 7 105695748 missense probably damaging 1.00
R5883:Dnhd1 UTSW 7 105720504 missense probably damaging 0.98
R6115:Dnhd1 UTSW 7 105713987 missense probably benign 0.00
R6119:Dnhd1 UTSW 7 105709440 missense probably benign 0.18
R6212:Dnhd1 UTSW 7 105704048 missense probably damaging 1.00
R6243:Dnhd1 UTSW 7 105652009 missense probably damaging 1.00
R6265:Dnhd1 UTSW 7 105693370 missense probably benign 0.07
R6332:Dnhd1 UTSW 7 105694066 missense probably benign 0.02
R6344:Dnhd1 UTSW 7 105694610 missense probably benign 0.38
R6477:Dnhd1 UTSW 7 105677886 missense probably benign 0.05
R6642:Dnhd1 UTSW 7 105703799 missense probably benign
R6663:Dnhd1 UTSW 7 105685692 intron probably null
R6730:Dnhd1 UTSW 7 105703875 missense probably benign 0.00
R6748:Dnhd1 UTSW 7 105720637 missense probably benign 0.03
R6833:Dnhd1 UTSW 7 105703373 missense probably benign 0.01
R6850:Dnhd1 UTSW 7 105719930 missense possibly damaging 0.68
R6853:Dnhd1 UTSW 7 105703728 missense probably benign
R6860:Dnhd1 UTSW 7 105678266 missense probably benign
R6898:Dnhd1 UTSW 7 105687377 missense probably damaging 0.99
R6927:Dnhd1 UTSW 7 105715563 missense probably damaging 1.00
R6952:Dnhd1 UTSW 7 105713688 missense probably damaging 1.00
R6987:Dnhd1 UTSW 7 105704585 missense probably damaging 0.98
R6988:Dnhd1 UTSW 7 105714210 missense probably damaging 1.00
Z1088:Dnhd1 UTSW 7 105712727 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAGACCTTAAGCAACAGTGAC -3'
(R):5'- CAACCAACTGCTTTTCAAGGTTTTC -3'

Sequencing Primer
(F):5'- CCTTAAGCAACAGTGACAGTGGATC -3'
(R):5'- GGACTCTCAAAGTTAGATCCCAGTG -3'
Posted On2016-03-01