Incidental Mutation 'R4822:Enpp1'
ID371223
Institutional Source Beutler Lab
Gene Symbol Enpp1
Ensembl Gene ENSMUSG00000037370
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 1
SynonymsPC-1, Npps, E-NPP1, Pca-1, twy, NPP1, 4833416E15Rik, Pdnp1, Pca, CD203c, Ly-41
MMRRC Submission 042438-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.257) question?
Stock #R4822 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location24637914-24712159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24661935 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 384 (M384K)
Ref Sequence ENSEMBL: ENSMUSP00000101159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039882] [ENSMUST00000105520] [ENSMUST00000135846]
Predicted Effect probably benign
Transcript: ENSMUST00000039882
SMART Domains Protein: ENSMUSP00000046090
Gene: ENSMUSG00000037370

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
low complexity region 59 69 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 358 1e-44 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105520
AA Change: M384K

PolyPhen 2 Score 0.744 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101159
Gene: ENSMUSG00000037370
AA Change: M384K

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 1.8e-87 PFAM
Endonuclease_NS 655 873 5.33e-15 SMART
NUC 656 887 3.62e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135846
AA Change: M384K

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000114273
Gene: ENSMUSG00000037370
AA Change: M384K

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 4.2e-91 PFAM
Endonuclease_NS 656 874 5.33e-15 SMART
NUC 657 888 3.62e-107 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150570
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (101/103)
MGI Phenotype FUNCTION: This gene encodes a member of the nucleoside pyrophosphatase/phosphodiesterase family of enzymes that catalyzes the hydrolysis of pyrophosphate and phosphodiester bonds in nucleotide triphosphates and oligonucleotides, respectively, to generate nucleoside 5'-monophosphates. The encoded protein is a type II transmembrane glycoprotein that negatively regulates bone mineralization. Mice harboring a nonsense mutation in this gene, termed tiptoe walking (ttw), exhibit ectopic ossification of the spinal ligaments. The encoded protein binds to the insulin receptor, inhibits downstream signaling events and induces insulin resistance and glucose tolerance. This gene is located adjacent to a paralog on chromosome 10. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele develop hyperostosis leading to ossific intervertebral fusion, peripheral joint ankylosis and tendon calcification, and display spontaneous arterial and articular cartilage calcification, and altered adipocyte maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik C T 14: 70,156,458 V243I probably benign Het
Acadvl C T 11: 70,011,184 G485S probably benign Het
Acap3 T A 4: 155,902,451 probably benign Het
Adamts19 A G 18: 58,890,284 I250M probably damaging Het
AF067061 A T 13: 120,264,150 T117S probably damaging Het
Amacr T A 15: 10,983,410 I102N probably damaging Het
Apob A G 12: 8,015,741 T4237A probably benign Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Bicd1 A T 6: 149,519,254 probably benign Het
Caskin2 T A 11: 115,807,299 E49V probably damaging Het
Cemip T A 7: 83,973,241 I577F probably benign Het
Chrnb1 T C 11: 69,795,675 S40G possibly damaging Het
Ctif C T 18: 75,521,561 C298Y probably benign Het
Cul9 A C 17: 46,530,051 H764Q probably benign Het
Cwf19l2 T A 9: 3,458,839 C763S probably damaging Het
Dhx57 A T 17: 80,242,167 probably null Het
Dnhd1 G A 7: 105,703,964 D2775N probably benign Het
Fat2 T C 11: 55,311,318 N310S probably benign Het
Fbxw7 A T 3: 84,967,507 Y232F possibly damaging Het
Fcamr T A 1: 130,812,686 S281T possibly damaging Het
Gm10762 C T 2: 128,967,186 W81* probably null Het
Gm5592 A G 7: 41,155,890 probably benign Het
Gm5745 T C 9: 73,175,698 noncoding transcript Het
Gm6185 G C 1: 161,213,254 noncoding transcript Het
Hid1 T A 11: 115,355,299 N382Y probably damaging Het
Hoxa10 A T 6: 52,232,589 F68I probably damaging Het
Ift88 T A 14: 57,441,869 probably null Het
Ighg2b A T 12: 113,306,391 *336R probably null Het
Ighv7-2 A C 12: 113,912,272 L37R probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnn3 G C 3: 89,667,289 V703L possibly damaging Het
Kiz C A 2: 146,891,069 S388R probably damaging Het
Klhl20 G A 1: 161,093,763 Q41* probably null Het
Krt31 T C 11: 100,047,784 I328V possibly damaging Het
Lama4 A T 10: 39,033,053 I330L probably benign Het
Lipo2 A T 19: 33,745,751 S213T probably benign Het
Lrsam1 A T 2: 32,926,792 I723N probably damaging Het
Man2b2 G A 5: 36,815,521 R550W probably damaging Het
Map4k5 A T 12: 69,841,984 L224* probably null Het
Mast3 A G 8: 70,780,366 S1101P probably damaging Het
Mertk A G 2: 128,801,305 S875G probably benign Het
Mmel1 A G 4: 154,887,897 M302V probably benign Het
Mrgpra3 T A 7: 47,589,968 H70L possibly damaging Het
Myh3 T A 11: 67,089,010 S592T probably benign Het
Nbeal2 T C 9: 110,636,315 I451V possibly damaging Het
Nup155 T A 15: 8,128,526 V489D possibly damaging Het
Obscn T A 11: 59,022,333 T6300S probably benign Het
Olfr1294 G T 2: 111,537,452 T279K probably damaging Het
Olfr1377 T A 11: 50,985,083 C127* probably null Het
Olfr290 A C 7: 84,916,426 I216L possibly damaging Het
Olfr350 A G 2: 36,850,876 M277V probably benign Het
Oprm1 A G 10: 6,829,036 I146V probably damaging Het
Otub1 A T 19: 7,204,429 D27E probably damaging Het
Pik3ca T C 3: 32,437,982 V243A probably benign Het
Pla2g12b G A 10: 59,416,514 probably null Het
Plekha8 A G 6: 54,624,561 D321G probably damaging Het
Pprc1 T C 19: 46,071,356 probably benign Het
Prkdc A G 16: 15,650,712 D129G possibly damaging Het
Rbms3 C T 9: 116,944,373 probably benign Het
Rictor T A 15: 6,791,680 V1495D probably benign Het
Rpl31-ps21 T C 5: 21,119,509 noncoding transcript Het
Ryr3 A T 2: 112,652,745 I4219N probably damaging Het
Sbf2 G A 7: 110,377,939 probably benign Het
Scn10a C T 9: 119,638,672 A801T probably damaging Het
Scn9a T A 2: 66,483,749 Y1866F possibly damaging Het
Sec1 A C 7: 45,679,303 Y107D probably damaging Het
Sema6d C T 2: 124,662,294 T619M possibly damaging Het
Sh2b3 C A 5: 121,828,555 probably benign Het
Slc2a4 A G 11: 69,946,587 V44A probably damaging Het
Slc5a12 T C 2: 110,621,740 I326T possibly damaging Het
Smarca5 T C 8: 80,708,680 probably null Het
Smarcd2 A G 11: 106,266,531 probably null Het
Snrpa1 A T 7: 66,069,573 probably benign Het
Sptbn5 T G 2: 120,067,968 K470Q probably benign Het
Stard9 T G 2: 120,695,941 V893G possibly damaging Het
Stx8 T G 11: 67,973,273 V53G possibly damaging Het
Sv2c A T 13: 95,985,949 W440R probably damaging Het
Tmem181a A T 17: 6,280,665 I67F probably benign Het
Tmprss7 C T 16: 45,663,316 C565Y probably damaging Het
Trafd1 A T 5: 121,378,498 L109H probably damaging Het
Trpv4 A G 5: 114,630,022 I422T possibly damaging Het
Usp24 T A 4: 106,416,047 Y2210N probably damaging Het
Vmn1r236 A T 17: 21,286,940 N107Y probably damaging Het
Vmn2r13 A T 5: 109,174,072 I253K probably damaging Het
Vmn2r2 T A 3: 64,134,539 I252F probably damaging Het
Vsig8 A G 1: 172,559,638 D27G probably damaging Het
Wdr92 T A 11: 17,227,165 N174K probably damaging Het
Wiz A T 17: 32,356,437 Y908* probably null Het
Wnk1 A T 6: 119,962,438 S1113T probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp691 G T 4: 119,170,567 T156K probably damaging Het
Zfp791 A T 8: 85,110,406 D276E probably benign Het
Other mutations in Enpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Enpp1 APN 10 24645427 missense possibly damaging 0.93
IGL00966:Enpp1 APN 10 24654031 missense probably damaging 1.00
IGL01364:Enpp1 APN 10 24664614 missense probably damaging 1.00
IGL02040:Enpp1 APN 10 24655856 missense probably damaging 1.00
IGL02143:Enpp1 APN 10 24677974 missense probably damaging 1.00
IGL02631:Enpp1 APN 10 24641961 missense probably damaging 1.00
IGL02655:Enpp1 APN 10 24677974 missense probably damaging 1.00
IGL02677:Enpp1 APN 10 24679185 splice site probably benign
IGL02691:Enpp1 APN 10 24711892 missense probably damaging 0.99
IGL02966:Enpp1 APN 10 24660274 missense probably damaging 1.00
IGL03087:Enpp1 APN 10 24655881 splice site probably benign
IGL03330:Enpp1 APN 10 24664906 splice site probably benign
IGL03365:Enpp1 APN 10 24669025 missense probably damaging 1.00
IGL03377:Enpp1 APN 10 24660283 critical splice acceptor site probably null
R0011:Enpp1 UTSW 10 24670002 nonsense probably null
R0201:Enpp1 UTSW 10 24653917 missense probably benign 0.00
R0496:Enpp1 UTSW 10 24672052 missense probably benign 0.18
R1228:Enpp1 UTSW 10 24645412 missense probably benign 0.30
R1536:Enpp1 UTSW 10 24641834 missense probably benign 0.27
R1927:Enpp1 UTSW 10 24654888 missense possibly damaging 0.65
R2051:Enpp1 UTSW 10 24711804 critical splice donor site probably null
R2057:Enpp1 UTSW 10 24660192 missense probably damaging 0.98
R2353:Enpp1 UTSW 10 24651341 missense probably benign 0.24
R4077:Enpp1 UTSW 10 24669007 critical splice donor site probably null
R4079:Enpp1 UTSW 10 24669007 critical splice donor site probably null
R4739:Enpp1 UTSW 10 24679248 missense probably null 0.99
R4740:Enpp1 UTSW 10 24679248 missense probably null 0.99
R4761:Enpp1 UTSW 10 24641951 missense possibly damaging 0.94
R4919:Enpp1 UTSW 10 24648085 missense probably benign 0.01
R5140:Enpp1 UTSW 10 24652852 missense possibly damaging 0.51
R5302:Enpp1 UTSW 10 24651390 missense probably benign
R5421:Enpp1 UTSW 10 24669757 missense probably damaging 1.00
R5695:Enpp1 UTSW 10 24654908 missense probably damaging 0.99
R5735:Enpp1 UTSW 10 24654919 missense possibly damaging 0.92
R5789:Enpp1 UTSW 10 24647239 missense probably benign
R5942:Enpp1 UTSW 10 24676068 nonsense probably null
R6048:Enpp1 UTSW 10 24660254 missense probably damaging 1.00
R6053:Enpp1 UTSW 10 24657126 missense possibly damaging 0.93
R6305:Enpp1 UTSW 10 24641882 missense probably damaging 1.00
R6319:Enpp1 UTSW 10 24648031 missense probably damaging 1.00
R6624:Enpp1 UTSW 10 24669755 nonsense probably null
R6793:Enpp1 UTSW 10 24655825 missense probably damaging 1.00
R6936:Enpp1 UTSW 10 24651339 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GGCTGGCCATATCCACAAATTTC -3'
(R):5'- GCTTATCAATGTTTCAATGGCCCC -3'

Sequencing Primer
(F):5'- GCAAAAAGCTTTATCTACAACCCTC -3'
(R):5'- AATGTTTCAATGGCCCCTTCCC -3'
Posted On2016-03-01