Incidental Mutation 'R0422:Acsm3'
ID37123
Institutional Source Beutler Lab
Gene Symbol Acsm3
Ensembl Gene ENSMUSG00000030935
Gene Nameacyl-CoA synthetase medium-chain family member 3
SynonymsSah, Sa
MMRRC Submission 038624-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0422 (G1)
Quality Score170
Status Not validated
Chromosome7
Chromosomal Location119760923-119787513 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 119773740 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 155 (Y155*)
Ref Sequence ENSEMBL: ENSMUSP00000102139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063770] [ENSMUST00000063902] [ENSMUST00000106523] [ENSMUST00000106526] [ENSMUST00000106527] [ENSMUST00000106528] [ENSMUST00000106529]
Predicted Effect probably null
Transcript: ENSMUST00000063770
AA Change: Y155*
SMART Domains Protein: ENSMUSP00000068803
Gene: ENSMUSG00000030935
AA Change: Y155*

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063902
SMART Domains Protein: ENSMUSP00000068633
Gene: ENSMUSG00000030929

DomainStartEndE-ValueType
EXOIII 36 235 1.41e-13 SMART
transmembrane domain 245 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106523
SMART Domains Protein: ENSMUSP00000102133
Gene: ENSMUSG00000030929

DomainStartEndE-ValueType
EXOIII 36 235 1.41e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106526
AA Change: Y155*
SMART Domains Protein: ENSMUSP00000102136
Gene: ENSMUSG00000030935
AA Change: Y155*

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106527
AA Change: Y155*
SMART Domains Protein: ENSMUSP00000102137
Gene: ENSMUSG00000030935
AA Change: Y155*

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106528
AA Change: Y155*
SMART Domains Protein: ENSMUSP00000102138
Gene: ENSMUSG00000030935
AA Change: Y155*

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106529
AA Change: Y155*
SMART Domains Protein: ENSMUSP00000102139
Gene: ENSMUSG00000030935
AA Change: Y155*

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 1.1e-78 PFAM
Pfam:AMP-binding_C 486 566 9.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149598
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149766
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with normal kidney function and morphology and blood pressure similar to wild-type on either a regular or high salt diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,199 S511P possibly damaging Het
Adamts16 A G 13: 70,738,955 C937R probably damaging Het
Akna T C 4: 63,392,154 D451G probably damaging Het
Alox12 A T 11: 70,254,558 V63E probably damaging Het
Ap3b1 T C 13: 94,462,460 I514T probably damaging Het
Arhgap23 T C 11: 97,463,652 M286T probably damaging Het
Cdkl2 T C 5: 92,020,312 D341G probably benign Het
Clip2 T C 5: 134,498,113 D813G probably benign Het
Cntnap3 A G 13: 64,757,285 V894A probably damaging Het
Coro2b T A 9: 62,427,977 Y304F probably benign Het
Dclre1a T A 19: 56,544,135 K676* probably null Het
Dmxl2 A G 9: 54,399,940 probably null Het
Dpep3 A G 8: 105,976,118 probably null Het
Efna5 C T 17: 62,607,419 A177T probably benign Het
Fabp1 G A 6: 71,203,093 V83I possibly damaging Het
H2-DMa G T 17: 34,137,947 G140C probably damaging Het
Hectd4 T A 5: 121,343,082 probably null Het
Hyou1 T A 9: 44,389,242 N869K probably damaging Het
Ing1 G A 8: 11,561,933 V124I probably damaging Het
Kalrn T A 16: 34,314,273 I380F probably damaging Het
Kcnh1 A G 1: 192,337,580 I378V probably benign Het
Kmt2c A G 5: 25,315,664 V1816A probably benign Het
Matn2 G A 15: 34,435,771 probably null Het
Naip2 C T 13: 100,161,113 S805N probably benign Het
Napsa A C 7: 44,585,106 Q254P probably damaging Het
Nat10 G T 2: 103,726,729 S860* probably null Het
Nipbl T C 15: 8,351,628 D560G probably benign Het
Nr3c2 A G 8: 77,185,967 M736V probably benign Het
Olfr1294 A T 2: 111,537,983 F102Y probably damaging Het
Olfr52 A T 2: 86,181,222 D296E probably benign Het
Olfr868 A T 9: 20,101,448 R230* probably null Het
Palm3 A G 8: 84,028,863 S335G possibly damaging Het
Panx1 G T 9: 15,007,816 S249* probably null Het
Parvb A G 15: 84,295,611 T231A probably benign Het
Pcdhb11 G T 18: 37,421,870 L84F probably damaging Het
Pi4k2b T C 5: 52,767,754 *447Q probably null Het
Ppp1r1a A G 15: 103,532,356 S125P probably benign Het
Prss1 T A 6: 41,463,312 D194E probably damaging Het
Rnf216 A T 5: 143,015,654 C772* probably null Het
Rnf216 A T 5: 143,090,370 F253Y probably benign Het
Rsf1 A T 7: 97,680,817 E1183D probably benign Het
Rusc1 T C 3: 89,086,825 T958A probably benign Het
Rxfp1 A G 3: 79,650,731 M480T probably benign Het
Slc22a16 T A 10: 40,591,890 V473E probably damaging Het
Slc26a3 A G 12: 31,465,849 T583A possibly damaging Het
Slc7a15 T C 12: 8,534,400 T117A probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Slitrk6 T A 14: 110,752,293 probably benign Het
Spata7 A G 12: 98,658,265 Y110C probably damaging Het
Supt16 T A 14: 52,183,996 I31F probably benign Het
Taar7a T C 10: 23,993,274 T70A probably benign Het
Top2a A G 11: 99,009,853 F594L probably damaging Het
Unc13d C T 11: 116,070,020 probably null Het
Unc80 T G 1: 66,483,338 V233G probably damaging Het
Wdr91 A T 6: 34,880,846 D735E probably damaging Het
Zzef1 A G 11: 72,866,091 T1141A possibly damaging Het
Other mutations in Acsm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Acsm3 APN 7 119784344 missense probably damaging 1.00
IGL01434:Acsm3 APN 7 119781074 unclassified probably benign
IGL01446:Acsm3 APN 7 119778454 missense probably damaging 1.00
IGL01800:Acsm3 APN 7 119774643 missense possibly damaging 0.68
IGL01882:Acsm3 APN 7 119774635 missense probably damaging 0.99
IGL01954:Acsm3 APN 7 119775083 splice site probably benign
PIT4677001:Acsm3 UTSW 7 119775117 missense probably damaging 1.00
PIT4696001:Acsm3 UTSW 7 119784986 splice site probably null
R0423:Acsm3 UTSW 7 119777159 missense probably damaging 1.00
R0729:Acsm3 UTSW 7 119783984 utr 3 prime probably benign
R0731:Acsm3 UTSW 7 119768024 nonsense probably null
R0732:Acsm3 UTSW 7 119773834 missense probably benign 0.40
R0744:Acsm3 UTSW 7 119777100 missense possibly damaging 0.84
R0836:Acsm3 UTSW 7 119777100 missense possibly damaging 0.84
R1926:Acsm3 UTSW 7 119777136 missense probably damaging 1.00
R2104:Acsm3 UTSW 7 119784304 missense probably benign
R2429:Acsm3 UTSW 7 119768000 missense probably benign
R3940:Acsm3 UTSW 7 119773886 missense probably benign 0.03
R4386:Acsm3 UTSW 7 119773871 missense probably damaging 1.00
R5437:Acsm3 UTSW 7 119778497 intron probably benign
R5890:Acsm3 UTSW 7 119775234 missense probably benign
R6278:Acsm3 UTSW 7 119773849 missense probably damaging 1.00
R6350:Acsm3 UTSW 7 119768033 missense probably benign
R6497:Acsm3 UTSW 7 119780749 critical splice acceptor site probably null
R6582:Acsm3 UTSW 7 119779673 missense probably benign
R6670:Acsm3 UTSW 7 119780755 unclassified probably null
R6939:Acsm3 UTSW 7 119778455 missense probably damaging 1.00
R7037:Acsm3 UTSW 7 119768043 missense probably damaging 1.00
R7087:Acsm3 UTSW 7 119774647 missense probably damaging 1.00
R7301:Acsm3 UTSW 7 119777085 missense possibly damaging 0.92
R7381:Acsm3 UTSW 7 119780826 missense probably damaging 0.98
R7396:Acsm3 UTSW 7 119773829 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGGCCATAGACTTGGAGACCTC -3'
(R):5'- CGTTGACCCCACTGCTACTGTATTG -3'

Sequencing Primer
(F):5'- CTTGGAGACCTCATGAAAGTGC -3'
(R):5'- GGGCACTGTTCTAAAATTCAGG -3'
Posted On2013-05-09