Incidental Mutation 'R4822:Nup155'
ID371249
Institutional Source Beutler Lab
Gene Symbol Nup155
Ensembl Gene ENSMUSG00000022142
Gene Namenucleoporin 155
SynonymsD930027M19Rik
MMRRC Submission 042438-MU
Accession Numbers

Genbank: NM_133227

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4822 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location8109273-8161247 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8128526 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 489 (V489D)
Ref Sequence ENSEMBL: ENSMUSP00000128819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163765] [ENSMUST00000230017]
Predicted Effect possibly damaging
Transcript: ENSMUST00000163765
AA Change: V489D

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128819
Gene: ENSMUSG00000022142
AA Change: V489D

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
Pfam:Nucleoporin_N 77 510 3.5e-105 PFAM
low complexity region 600 619 N/A INTRINSIC
Pfam:Nucleoporin_C 678 1221 3.6e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229466
Predicted Effect probably benign
Transcript: ENSMUST00000230017
AA Change: V489D

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
Meta Mutation Damage Score 0.296 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (101/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleoporins are proteins that play an important role in the assembly and functioning of the nuclear pore complex (NPC) which regulates the movement of macromolecules across the nuclear envelope (NE). The protein encoded by this gene plays a role in the fusion of NE vesicles and formation of the double membrane NE. The protein may also be involved in cardiac physiology and may be associated with the pathogenesis of atrial fibrillation. Alternative splicing results in multiple transcript variants of this gene. A pseudogene associated with this gene is located on chromosome 6. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to E8.5. Mice homozygous for a gene trap allele exhibit atria fibrillation associated with shortened action potential duration. [provided by MGI curators]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik C T 14: 70,156,458 V243I probably benign Het
Acadvl C T 11: 70,011,184 G485S probably benign Het
Acap3 T A 4: 155,902,451 probably benign Het
Adamts19 A G 18: 58,890,284 I250M probably damaging Het
AF067061 A T 13: 120,264,150 T117S probably damaging Het
Amacr T A 15: 10,983,410 I102N probably damaging Het
Apob A G 12: 8,015,741 T4237A probably benign Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Bicd1 A T 6: 149,519,254 probably benign Het
Caskin2 T A 11: 115,807,299 E49V probably damaging Het
Cemip T A 7: 83,973,241 I577F probably benign Het
Chrnb1 T C 11: 69,795,675 S40G possibly damaging Het
Ctif C T 18: 75,521,561 C298Y probably benign Het
Cul9 A C 17: 46,530,051 H764Q probably benign Het
Cwf19l2 T A 9: 3,458,839 C763S probably damaging Het
Dhx57 A T 17: 80,242,167 probably null Het
Dnhd1 G A 7: 105,703,964 D2775N probably benign Het
Enpp1 A T 10: 24,661,935 M384K possibly damaging Het
Fat2 T C 11: 55,311,318 N310S probably benign Het
Fbxw7 A T 3: 84,967,507 Y232F possibly damaging Het
Fcamr T A 1: 130,812,686 S281T possibly damaging Het
Gm10762 C T 2: 128,967,186 W81* probably null Het
Gm5592 A G 7: 41,155,890 probably benign Het
Gm5745 T C 9: 73,175,698 noncoding transcript Het
Gm6185 G C 1: 161,213,254 noncoding transcript Het
Hid1 T A 11: 115,355,299 N382Y probably damaging Het
Hoxa10 A T 6: 52,232,589 F68I probably damaging Het
Ift88 T A 14: 57,441,869 probably null Het
Ighg2b A T 12: 113,306,391 *336R probably null Het
Ighv7-2 A C 12: 113,912,272 L37R probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnn3 G C 3: 89,667,289 V703L possibly damaging Het
Kiz C A 2: 146,891,069 S388R probably damaging Het
Klhl20 G A 1: 161,093,763 Q41* probably null Het
Krt31 T C 11: 100,047,784 I328V possibly damaging Het
Lama4 A T 10: 39,033,053 I330L probably benign Het
Lipo2 A T 19: 33,745,751 S213T probably benign Het
Lrsam1 A T 2: 32,926,792 I723N probably damaging Het
Man2b2 G A 5: 36,815,521 R550W probably damaging Het
Map4k5 A T 12: 69,841,984 L224* probably null Het
Mast3 A G 8: 70,780,366 S1101P probably damaging Het
Mertk A G 2: 128,801,305 S875G probably benign Het
Mmel1 A G 4: 154,887,897 M302V probably benign Het
Mrgpra3 T A 7: 47,589,968 H70L possibly damaging Het
Myh3 T A 11: 67,089,010 S592T probably benign Het
Nbeal2 T C 9: 110,636,315 I451V possibly damaging Het
Obscn T A 11: 59,022,333 T6300S probably benign Het
Olfr1294 G T 2: 111,537,452 T279K probably damaging Het
Olfr1377 T A 11: 50,985,083 C127* probably null Het
Olfr290 A C 7: 84,916,426 I216L possibly damaging Het
Olfr350 A G 2: 36,850,876 M277V probably benign Het
Oprm1 A G 10: 6,829,036 I146V probably damaging Het
Otub1 A T 19: 7,204,429 D27E probably damaging Het
Pik3ca T C 3: 32,437,982 V243A probably benign Het
Pla2g12b G A 10: 59,416,514 probably null Het
Plekha8 A G 6: 54,624,561 D321G probably damaging Het
Pprc1 T C 19: 46,071,356 probably benign Het
Prkdc A G 16: 15,650,712 D129G possibly damaging Het
Rbms3 C T 9: 116,944,373 probably benign Het
Rictor T A 15: 6,791,680 V1495D probably benign Het
Rpl31-ps21 T C 5: 21,119,509 noncoding transcript Het
Ryr3 A T 2: 112,652,745 I4219N probably damaging Het
Sbf2 G A 7: 110,377,939 probably benign Het
Scn10a C T 9: 119,638,672 A801T probably damaging Het
Scn9a T A 2: 66,483,749 Y1866F possibly damaging Het
Sec1 A C 7: 45,679,303 Y107D probably damaging Het
Sema6d C T 2: 124,662,294 T619M possibly damaging Het
Sh2b3 C A 5: 121,828,555 probably benign Het
Slc2a4 A G 11: 69,946,587 V44A probably damaging Het
Slc5a12 T C 2: 110,621,740 I326T possibly damaging Het
Smarca5 T C 8: 80,708,680 probably null Het
Smarcd2 A G 11: 106,266,531 probably null Het
Snrpa1 A T 7: 66,069,573 probably benign Het
Sptbn5 T G 2: 120,067,968 K470Q probably benign Het
Stard9 T G 2: 120,695,941 V893G possibly damaging Het
Stx8 T G 11: 67,973,273 V53G possibly damaging Het
Sv2c A T 13: 95,985,949 W440R probably damaging Het
Tmem181a A T 17: 6,280,665 I67F probably benign Het
Tmprss7 C T 16: 45,663,316 C565Y probably damaging Het
Trafd1 A T 5: 121,378,498 L109H probably damaging Het
Trpv4 A G 5: 114,630,022 I422T possibly damaging Het
Usp24 T A 4: 106,416,047 Y2210N probably damaging Het
Vmn1r236 A T 17: 21,286,940 N107Y probably damaging Het
Vmn2r13 A T 5: 109,174,072 I253K probably damaging Het
Vmn2r2 T A 3: 64,134,539 I252F probably damaging Het
Vsig8 A G 1: 172,559,638 D27G probably damaging Het
Wdr92 T A 11: 17,227,165 N174K probably damaging Het
Wiz A T 17: 32,356,437 Y908* probably null Het
Wnk1 A T 6: 119,962,438 S1113T probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp691 G T 4: 119,170,567 T156K probably damaging Het
Zfp791 A T 8: 85,110,406 D276E probably benign Het
Other mutations in Nup155
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Nup155 APN 15 8121455 splice site probably benign
IGL00426:Nup155 APN 15 8156794 makesense probably null
IGL00765:Nup155 APN 15 8153228 missense probably benign 0.16
IGL00936:Nup155 APN 15 8128405 splice site probably benign
IGL01124:Nup155 APN 15 8153679 missense probably damaging 0.97
IGL01739:Nup155 APN 15 8135788 missense probably benign 0.01
IGL02013:Nup155 APN 15 8113648 missense possibly damaging 0.61
IGL02066:Nup155 APN 15 8157766 unclassified probably benign
IGL02231:Nup155 APN 15 8144064 missense probably damaging 1.00
IGL02246:Nup155 APN 15 8143002 missense probably benign
IGL02289:Nup155 APN 15 8131493 missense probably damaging 1.00
IGL02608:Nup155 APN 15 8109471 missense probably benign
IGL02749:Nup155 APN 15 8134076 missense probably damaging 1.00
IGL02813:Nup155 APN 15 8130121 splice site probably benign
IGL03102:Nup155 APN 15 8147284 missense probably benign 0.00
H8930:Nup155 UTSW 15 8157658 missense possibly damaging 0.50
IGL02835:Nup155 UTSW 15 8143130 missense probably damaging 1.00
R0314:Nup155 UTSW 15 8147252 missense probably benign 0.00
R0365:Nup155 UTSW 15 8131543 missense probably damaging 1.00
R0586:Nup155 UTSW 15 8130232 missense probably benign 0.39
R0764:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R0839:Nup155 UTSW 15 8145587 missense possibly damaging 0.48
R0844:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1066:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1067:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1085:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1137:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1162:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1166:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1202:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1203:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1219:Nup155 UTSW 15 8117338 missense possibly damaging 0.80
R1385:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1421:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1448:Nup155 UTSW 15 8112406 missense probably benign 0.44
R1611:Nup155 UTSW 15 8130160 missense probably damaging 1.00
R1836:Nup155 UTSW 15 8154980 missense possibly damaging 0.79
R1863:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1866:Nup155 UTSW 15 8115526 missense probably damaging 1.00
R1894:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1976:Nup155 UTSW 15 8135827 missense probably benign 0.01
R2024:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R2026:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R2027:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R2077:Nup155 UTSW 15 8143026 missense probably damaging 1.00
R2111:Nup155 UTSW 15 8121467 missense probably benign 0.45
R2921:Nup155 UTSW 15 8153641 missense probably damaging 1.00
R2936:Nup155 UTSW 15 8143049 missense possibly damaging 0.89
R3108:Nup155 UTSW 15 8117306 missense probably null 1.00
R3161:Nup155 UTSW 15 8148383 missense possibly damaging 0.56
R3162:Nup155 UTSW 15 8148383 missense possibly damaging 0.56
R3162:Nup155 UTSW 15 8148383 missense possibly damaging 0.56
R3522:Nup155 UTSW 15 8156678 splice site probably benign
R4423:Nup155 UTSW 15 8121464 missense probably damaging 0.99
R4451:Nup155 UTSW 15 8150882 missense probably benign 0.02
R4498:Nup155 UTSW 15 8153673 missense possibly damaging 0.88
R4780:Nup155 UTSW 15 8157703 missense probably benign 0.00
R5013:Nup155 UTSW 15 8124238 missense probably benign 0.00
R5064:Nup155 UTSW 15 8135870 missense probably damaging 1.00
R5172:Nup155 UTSW 15 8109542 missense probably benign 0.06
R5406:Nup155 UTSW 15 8153638 critical splice acceptor site probably null
R5551:Nup155 UTSW 15 8148333 missense probably benign 0.09
R5588:Nup155 UTSW 15 8119253 critical splice donor site probably null
R5977:Nup155 UTSW 15 8130237 critical splice donor site probably null
R6035:Nup155 UTSW 15 8144093 missense probably benign
R6035:Nup155 UTSW 15 8144093 missense probably benign
R6036:Nup155 UTSW 15 8128411 missense probably benign 0.16
R6036:Nup155 UTSW 15 8128411 missense probably benign 0.16
R6085:Nup155 UTSW 15 8148358 missense probably damaging 0.98
R6188:Nup155 UTSW 15 8109575 missense probably damaging 1.00
R6232:Nup155 UTSW 15 8109479 missense probably benign 0.02
R6257:Nup155 UTSW 15 8150798 nonsense probably null
R6262:Nup155 UTSW 15 8156741 missense probably benign 0.03
R6267:Nup155 UTSW 15 8153155 missense probably damaging 1.00
R6296:Nup155 UTSW 15 8153155 missense probably damaging 1.00
R6299:Nup155 UTSW 15 8128438 missense possibly damaging 0.88
R6303:Nup155 UTSW 15 8118042 missense probably damaging 1.00
R6304:Nup155 UTSW 15 8118042 missense probably damaging 1.00
R6763:Nup155 UTSW 15 8135895 nonsense probably null
R6958:Nup155 UTSW 15 8147154 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCTTTGGCATGTGTGAC -3'
(R):5'- AAGTGGCAGCTGAGAGTATTTG -3'

Sequencing Primer
(F):5'- AAGCTTTGGCATGTGTGACTTCAAC -3'
(R):5'- CAGCTGAGAGTATTTGACAAAAGC -3'
Posted On2016-03-01