Incidental Mutation 'R4823:Ascc3'
ID371309
Institutional Source Beutler Lab
Gene Symbol Ascc3
Ensembl Gene ENSMUSG00000038774
Gene Nameactivating signal cointegrator 1 complex subunit 3
SynonymsB630009I04Rik, ASC1p200, Helic1
MMRRC Submission 042439-MU
Accession Numbers

Ncbi RefSeq: NM_198007.2; MGI:1925237

Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R4823 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location50592669-50851485 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50713233 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1017 (S1017P)
Ref Sequence ENSEMBL: ENSMUSP00000036726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035606]
Predicted Effect probably damaging
Transcript: ENSMUST00000035606
AA Change: S1017P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000036726
Gene: ENSMUSG00000038774
AA Change: S1017P

DomainStartEndE-ValueType
coiled coil region 55 79 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
coiled coil region 329 356 N/A INTRINSIC
DEXDc 474 686 1.71e-29 SMART
AAA 492 674 8.15e-2 SMART
Blast:DEXDc 718 763 4e-18 BLAST
HELICc 770 858 6.01e-16 SMART
Sec63 979 1288 3.53e-111 SMART
DEXDc 1324 1528 8.88e-28 SMART
AAA 1342 1492 4.27e-1 SMART
HELICc 1605 1695 2.28e-16 SMART
Sec63 1813 2178 6.37e-118 SMART
Meta Mutation Damage Score 0.386 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 98% (96/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a family of helicases that are involved in the ATP-dependent unwinding of nucleic acid duplexes. The encoded protein is the largest subunit of the activating signal cointegrator 1 complex that is involved in DNA repair and resistance to alkylation damage. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI

All alleles(16) : Targeted(2) Gene trapped(14)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik G A 5: 87,972,598 D405N probably benign Het
4921517D22Rik T G 13: 59,690,904 E38A probably damaging Het
4930433I11Rik A T 7: 40,993,362 I152F probably benign Het
5830473C10Rik T A 5: 90,566,503 L124H probably benign Het
Aass A T 6: 23,107,691 D364E probably benign Het
Adamts2 A G 11: 50,737,187 D238G probably benign Het
Aplf G A 6: 87,646,255 L302F probably damaging Het
Apol7b G T 15: 77,427,782 probably benign Het
Arhgef12 A G 9: 43,020,696 V165A probably benign Het
B230104I21Rik T A 4: 154,349,747 probably benign Het
Bfsp2 C A 9: 103,479,883 C115F probably damaging Het
Bhmt2 A T 13: 93,663,290 W213R probably benign Het
C87499 T C 4: 88,629,215 K160R probably damaging Het
Capn5 A T 7: 98,126,441 V431E probably damaging Het
Ccdc88c A G 12: 100,930,543 Y1390H probably damaging Het
Ccr3 A G 9: 124,028,681 T18A probably damaging Het
Cdh5 T C 8: 104,142,669 S676P probably benign Het
Ceacam5 A G 7: 17,757,744 T680A possibly damaging Het
Cebpd G A 16: 15,888,114 G264S probably benign Het
Cfd T C 10: 79,890,948 V8A probably benign Het
Cops9 C T 1: 92,641,866 probably benign Het
Cpne6 T C 14: 55,517,010 Y533H probably damaging Het
Cyp2c67 T A 19: 39,615,724 H396L probably benign Het
Cyp2j9 G A 4: 96,568,735 P500S possibly damaging Het
Cyp4a12a A T 4: 115,327,413 probably null Het
Dbt G A 3: 116,523,387 D71N probably damaging Het
Ddx41 G T 13: 55,532,055 Q440K probably benign Het
Doxl2 A G 6: 48,975,261 D40G probably damaging Het
Elovl4 A G 9: 83,780,685 F174S probably damaging Het
Emcn C G 3: 137,423,426 P193R probably damaging Het
Etnk1 T C 6: 143,167,638 probably null Het
Fads3 A C 19: 10,041,888 S53R probably damaging Het
Fam193a A G 5: 34,459,028 E849G probably damaging Het
Fat3 A G 9: 15,996,507 V2733A probably benign Het
Frem3 T A 8: 80,613,958 M960K probably benign Het
Frmd6 A T 12: 70,872,575 I62L probably benign Het
Glmp T C 3: 88,325,223 probably benign Het
Gm17421 T C 12: 113,369,541 noncoding transcript Het
Gm27013 T A 6: 130,522,223 noncoding transcript Het
Gtf2ird1 A G 5: 134,395,722 V390A probably damaging Het
Hps3 A G 3: 20,012,726 Y559H probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Itpr3 A G 17: 27,085,147 D114G probably benign Het
Jmjd4 G A 11: 59,455,580 A408T probably benign Het
Kcnh4 G T 11: 100,755,174 A316D probably damaging Het
Klrg1 T A 6: 122,273,533 probably null Het
Lancl2 T A 6: 57,732,277 Y355N probably damaging Het
Ltb T C 17: 35,195,230 S115P probably benign Het
Mccc2 T G 13: 100,000,254 R64S probably benign Het
Mgam2-ps T A 6: 40,832,662 noncoding transcript Het
Mrrf T G 2: 36,148,030 N104K possibly damaging Het
Nipa1 C A 7: 55,979,688 V226L possibly damaging Het
Numa1 T A 7: 101,996,037 L290Q probably damaging Het
Ofcc1 T A 13: 40,280,473 H52L probably damaging Het
Ogfod3 G A 11: 121,195,201 A189V probably benign Het
Olfr1176 A G 2: 88,339,835 D90G probably damaging Het
Olfr1444 A T 19: 12,861,816 I14F probably benign Het
Olfr1505 G A 19: 13,919,658 V213I probably benign Het
Olfr292 T A 7: 86,694,588 I44N probably damaging Het
P2ry12 G A 3: 59,217,897 S119L probably benign Het
Pde7b T A 10: 20,438,785 N192Y probably damaging Het
Pfkl T C 10: 77,997,594 N258S probably damaging Het
Phykpl G A 11: 51,586,593 A71T probably damaging Het
Ppp1r16a T C 15: 76,693,193 probably benign Het
Pramef20 T C 4: 144,373,211 N328S possibly damaging Het
Prune2 C T 19: 17,120,504 T1124M probably damaging Het
Rapgef6 A G 11: 54,694,500 I1570V probably benign Het
Rbm34 T C 8: 126,970,905 S19G probably benign Het
Rnf10 T C 5: 115,255,442 probably null Het
Rnf34 A G 5: 122,850,302 probably null Het
Setd4 A G 16: 93,589,950 S287P probably benign Het
Shc3 C T 13: 51,451,570 V225I probably benign Het
Sipa1l3 C T 7: 29,371,002 V1030I probably damaging Het
Siva1 G T 12: 112,645,064 R33L probably damaging Het
Slc4a5 C T 6: 83,272,133 T573I probably damaging Het
Sorcs1 C T 19: 50,678,140 R110Q possibly damaging Het
Sorcs1 T C 19: 50,230,302 I581V possibly damaging Het
Sorl1 T C 9: 41,992,321 D1545G probably damaging Het
Tas2r124 T G 6: 132,755,546 S273A probably damaging Het
Tcf15 T C 2: 152,143,893 F90L probably damaging Het
Trim59 G A 3: 69,037,120 R296C probably benign Het
Tulp1 A T 17: 28,353,572 D229E probably benign Het
Ush1c T A 7: 46,195,733 N886I probably benign Het
Usp9y A T Y: 1,444,559 S127T probably damaging Het
Vmn1r19 T A 6: 57,405,234 Y257* probably null Het
Vmn2r109 A T 17: 20,553,891 Y401N probably damaging Het
Vmn2r69 A C 7: 85,411,300 S359A probably benign Het
Zfp37 A T 4: 62,191,503 N479K probably benign Het
Other mutations in Ascc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Ascc3 APN 10 50714435 missense probably damaging 0.99
IGL00690:Ascc3 APN 10 50699943 nonsense probably null
IGL00897:Ascc3 APN 10 50728091 missense probably benign 0.01
IGL01077:Ascc3 APN 10 50649317 splice site probably benign
IGL01124:Ascc3 APN 10 50732473 missense probably damaging 1.00
IGL01555:Ascc3 APN 10 50750522 missense probably damaging 1.00
IGL02019:Ascc3 APN 10 50690139 missense probably damaging 1.00
IGL02161:Ascc3 APN 10 50850527 nonsense probably null
IGL02247:Ascc3 APN 10 50650590 missense probably damaging 1.00
IGL02318:Ascc3 APN 10 50728154 nonsense probably null
IGL02428:Ascc3 APN 10 50845695 nonsense probably null
IGL02432:Ascc3 APN 10 50700493 missense probably damaging 0.99
IGL02449:Ascc3 APN 10 50700599 missense probably benign 0.00
IGL02640:Ascc3 APN 10 50767374 missense possibly damaging 0.69
IGL02673:Ascc3 APN 10 50660673 missense probably benign 0.01
IGL03144:Ascc3 APN 10 50767443 missense probably benign 0.16
IGL03161:Ascc3 APN 10 50618072 missense probably damaging 0.98
IGL03218:Ascc3 APN 10 50823853 missense possibly damaging 0.89
R0045:Ascc3 UTSW 10 50718402 nonsense probably null
R0045:Ascc3 UTSW 10 50718402 nonsense probably null
R0131:Ascc3 UTSW 10 50735329 missense probably damaging 0.99
R0131:Ascc3 UTSW 10 50735329 missense probably damaging 0.99
R0132:Ascc3 UTSW 10 50735329 missense probably damaging 0.99
R0149:Ascc3 UTSW 10 50607993 missense probably benign 0.31
R0165:Ascc3 UTSW 10 50842127 intron probably null
R0255:Ascc3 UTSW 10 50645058 missense probably benign 0.00
R0310:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0314:Ascc3 UTSW 10 50637999 missense possibly damaging 0.92
R0362:Ascc3 UTSW 10 50748955 splice site probably benign
R0418:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0419:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0421:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0480:Ascc3 UTSW 10 50735252 missense probably damaging 1.00
R0744:Ascc3 UTSW 10 50845666 missense probably benign 0.17
R0833:Ascc3 UTSW 10 50845666 missense probably benign 0.17
R1231:Ascc3 UTSW 10 50823660 missense probably damaging 1.00
R1264:Ascc3 UTSW 10 50642519 splice site probably benign
R1302:Ascc3 UTSW 10 50604794 start codon destroyed probably null 1.00
R1751:Ascc3 UTSW 10 50718376 missense probably damaging 0.97
R1767:Ascc3 UTSW 10 50718376 missense probably damaging 0.97
R1769:Ascc3 UTSW 10 50700490 missense probably damaging 1.00
R1840:Ascc3 UTSW 10 50690161 missense probably benign 0.00
R1855:Ascc3 UTSW 10 50617922 missense probably benign 0.01
R1953:Ascc3 UTSW 10 50845630 missense probably benign
R1976:Ascc3 UTSW 10 50649166 missense probably damaging 1.00
R2004:Ascc3 UTSW 10 50617742 missense probably damaging 1.00
R2013:Ascc3 UTSW 10 50649812 missense probably damaging 0.99
R2017:Ascc3 UTSW 10 50690211 missense probably benign 0.00
R2040:Ascc3 UTSW 10 50728131 missense probably benign
R2043:Ascc3 UTSW 10 50700520 missense probably damaging 1.00
R2165:Ascc3 UTSW 10 50721839 missense probably damaging 1.00
R2226:Ascc3 UTSW 10 50754052 missense probably benign 0.07
R2310:Ascc3 UTSW 10 50748892 missense probably benign 0.15
R2405:Ascc3 UTSW 10 50731678 missense probably damaging 1.00
R2424:Ascc3 UTSW 10 50618201 missense probably benign 0.14
R3410:Ascc3 UTSW 10 50700100 missense probably damaging 1.00
R3617:Ascc3 UTSW 10 50618185 missense probably benign 0.00
R3771:Ascc3 UTSW 10 50720718 splice site probably benign
R3783:Ascc3 UTSW 10 50728254 missense probably damaging 1.00
R3891:Ascc3 UTSW 10 50842193 missense probably damaging 0.99
R3892:Ascc3 UTSW 10 50842193 missense probably damaging 0.99
R4435:Ascc3 UTSW 10 50721885 missense probably benign 0.14
R4509:Ascc3 UTSW 10 50842243 missense probably benign 0.00
R4520:Ascc3 UTSW 10 50660670 missense probably benign
R4521:Ascc3 UTSW 10 50660670 missense probably benign
R4522:Ascc3 UTSW 10 50660670 missense probably benign
R4524:Ascc3 UTSW 10 50660670 missense probably benign
R4581:Ascc3 UTSW 10 50711025 missense probably damaging 1.00
R4701:Ascc3 UTSW 10 50720664 missense possibly damaging 0.66
R4704:Ascc3 UTSW 10 50659014 missense probably benign 0.02
R4768:Ascc3 UTSW 10 50700499 missense probably damaging 1.00
R4906:Ascc3 UTSW 10 50749131 missense probably damaging 1.00
R4937:Ascc3 UTSW 10 50823798 missense probably damaging 1.00
R5001:Ascc3 UTSW 10 50823648 missense probably damaging 1.00
R5151:Ascc3 UTSW 10 50637963 missense probably damaging 0.99
R5263:Ascc3 UTSW 10 50716661 missense probably benign 0.00
R5302:Ascc3 UTSW 10 50707777 missense probably benign 0.09
R5436:Ascc3 UTSW 10 50658983 missense probably damaging 0.99
R5455:Ascc3 UTSW 10 50849583 missense probably benign 0.06
R5474:Ascc3 UTSW 10 50849538 missense probably benign 0.25
R5744:Ascc3 UTSW 10 50710881 missense probably benign
R5781:Ascc3 UTSW 10 50637978 missense probably damaging 1.00
R5850:Ascc3 UTSW 10 50710953 missense probably damaging 1.00
R5867:Ascc3 UTSW 10 50842183 nonsense probably null
R5868:Ascc3 UTSW 10 50842183 nonsense probably null
R5869:Ascc3 UTSW 10 50842183 nonsense probably null
R6031:Ascc3 UTSW 10 50842183 nonsense probably null
R6031:Ascc3 UTSW 10 50842183 nonsense probably null
R6032:Ascc3 UTSW 10 50842183 nonsense probably null
R6032:Ascc3 UTSW 10 50842183 nonsense probably null
R6109:Ascc3 UTSW 10 50649247 missense probably benign 0.37
R6122:Ascc3 UTSW 10 50617925 missense probably benign
R6128:Ascc3 UTSW 10 50650638 missense probably damaging 1.00
R6351:Ascc3 UTSW 10 50720673 missense probably damaging 0.99
R6368:Ascc3 UTSW 10 50699985 missense probably damaging 1.00
R6369:Ascc3 UTSW 10 50699985 missense probably damaging 1.00
R6409:Ascc3 UTSW 10 50845580 missense probably benign 0.09
R6472:Ascc3 UTSW 10 50720687 missense probably benign 0.03
R6474:Ascc3 UTSW 10 50748836 missense probably benign 0.01
R6480:Ascc3 UTSW 10 50710953 missense probably damaging 1.00
R6553:Ascc3 UTSW 10 50842177 missense probably benign 0.05
R6572:Ascc3 UTSW 10 50690247 nonsense probably null
R6585:Ascc3 UTSW 10 50842177 missense probably benign 0.05
R6656:Ascc3 UTSW 10 50649925 nonsense probably null
R6669:Ascc3 UTSW 10 50840373 missense probably benign
R6675:Ascc3 UTSW 10 50750563 nonsense probably null
R6790:Ascc3 UTSW 10 50645712 missense probably damaging 1.00
R6856:Ascc3 UTSW 10 50749062 missense probably damaging 1.00
R6862:Ascc3 UTSW 10 50849646 missense probably null 0.51
R6919:Ascc3 UTSW 10 50645753 nonsense probably null
R6936:Ascc3 UTSW 10 50729961 missense probably damaging 0.98
R6953:Ascc3 UTSW 10 50645666 missense probably benign 0.00
R6957:Ascc3 UTSW 10 50728182 missense probably damaging 1.00
R7022:Ascc3 UTSW 10 50716629 missense possibly damaging 0.55
R7050:Ascc3 UTSW 10 50840350 missense probably benign 0.43
R7358:Ascc3 UTSW 10 50714352 nonsense probably null
X0021:Ascc3 UTSW 10 50700590 missense possibly damaging 0.88
X0025:Ascc3 UTSW 10 50650596 missense probably benign 0.00
X0026:Ascc3 UTSW 10 50732478 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGATTTTGCTAAATACCTGCC -3'
(R):5'- TTTTGGGCAAAAGCAACAAATGTTG -3'

Sequencing Primer
(F):5'- ATACCTGCCTTTATTTATATTCTCGC -3'
(R):5'- GAGGTATAATTTAGGATAGTGGA -3'
Posted On2016-03-01