Incidental Mutation 'R4825:Glul'
ID371345
Institutional Source Beutler Lab
Gene Symbol Glul
Ensembl Gene ENSMUSG00000026473
Gene Nameglutamate-ammonia ligase (glutamine synthetase)
SynonymsGS, Glns
MMRRC Submission 042441-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4825 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location153899944-153909723 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 153903044 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 33 (V33A)
Ref Sequence ENSEMBL: ENSMUSP00000123157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086199] [ENSMUST00000123490] [ENSMUST00000139476] [ENSMUST00000140685]
Predicted Effect probably benign
Transcript: ENSMUST00000086199
AA Change: V33A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000083375
Gene: ENSMUSG00000026473
AA Change: V33A

DomainStartEndE-ValueType
Pfam:Gln-synt_N 24 104 1.1e-15 PFAM
Gln-synt_C 110 359 6.09e-74 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123490
SMART Domains Protein: ENSMUSP00000115023
Gene: ENSMUSG00000045968

DomainStartEndE-ValueType
Pfam:DUF716 71 195 6.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139476
AA Change: V33A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114377
Gene: ENSMUSG00000026473
AA Change: V33A

DomainStartEndE-ValueType
Pfam:Gln-synt_N 24 104 8.8e-23 PFAM
Pfam:Gln-synt_C 110 199 1.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140685
AA Change: V33A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000123157
Gene: ENSMUSG00000026473
AA Change: V33A

DomainStartEndE-ValueType
Pfam:Gln-synt_N 24 104 1.7e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153134
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190620
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glutamine synthetase family. It catalyzes the synthesis of glutamine from glutamate and ammonia in an ATP-dependent reaction. This protein plays a role in ammonia and glutamate detoxification, acid-base homeostasis, cell signaling, and cell proliferation. Glutamine is an abundant amino acid, and is important to the biosynthesis of several amino acids, pyrimidines, and purines. Mutations in this gene are associated with congenital glutamine deficiency, and overexpression of this gene was observed in some primary liver cancer samples. There are six pseudogenes of this gene found on chromosomes 2, 5, 9, 11, and 12. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Embryos homozygous for a reporter/null allele are not viable after E3.5; however, mutant E2.5 embryonic cells can survive in vitro if provided with glutamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 130 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik C A 11: 109,791,672 L229F probably benign Het
A930002H24Rik A C 17: 63,863,608 S62A unknown Het
Abca12 T A 1: 71,302,685 Q1039L possibly damaging Het
Adgrg5 T A 8: 94,941,734 F476I possibly damaging Het
AI314180 G A 4: 58,850,911 L421F probably damaging Het
Alms1 A G 6: 85,678,245 K2789E probably damaging Het
Arrdc2 G A 8: 70,839,277 probably null Het
Atp2b1 T A 10: 99,009,564 I743K probably damaging Het
Atp6v1c2 C T 12: 17,289,060 G230D probably benign Het
AU040320 G A 4: 126,791,793 C54Y probably damaging Het
BC024139 C T 15: 76,120,317 V680I possibly damaging Het
Bckdhb A G 9: 83,988,905 D156G probably damaging Het
Canx T A 11: 50,308,809 D143V probably benign Het
Ccdc180 T A 4: 45,912,794 V591E possibly damaging Het
Ccno T C 13: 112,988,099 S68P probably benign Het
Cdc45 C T 16: 18,784,863 E527K probably damaging Het
Cep290 T A 10: 100,488,348 D14E probably damaging Het
Cgnl1 A G 9: 71,630,524 V1238A probably benign Het
Ciz1 C T 2: 32,371,741 A455V probably damaging Het
Coro2b T A 9: 62,454,623 Y86F probably benign Het
Csf2ra C T 19: 61,226,552 R158Q probably benign Het
Cubn A T 2: 13,325,225 I2615N probably damaging Het
Dhx8 C T 11: 101,738,170 R129* probably null Het
Disc1 T A 8: 125,135,302 M471K possibly damaging Het
Dmxl2 G T 9: 54,404,041 L1799I probably benign Het
Dnah2 A G 11: 69,423,205 S4108P probably damaging Het
Ehmt2 C G 17: 34,906,964 P211R probably benign Het
Eif4g3 A G 4: 138,194,081 D1557G probably benign Het
Epha5 T C 5: 84,233,840 D384G probably damaging Het
Etl4 A G 2: 20,806,927 I1274V probably damaging Het
Fam160a1 G A 3: 85,673,432 P489S possibly damaging Het
Fip1l1 G A 5: 74,588,205 probably null Het
Fubp1 T C 3: 152,217,890 probably null Het
Gm4846 A G 1: 166,491,668 F167S probably damaging Het
Heatr6 T A 11: 83,758,322 L168M probably damaging Het
Hif1a T A 12: 73,932,401 I233N probably damaging Het
Hivep2 T A 10: 14,131,319 H1220Q possibly damaging Het
Igkv8-21 T C 6: 70,315,426 I9M probably benign Het
Izumo1 T A 7: 45,624,987 C62* probably null Het
Jakmip3 G A 7: 139,026,766 E424K probably damaging Het
Klhl2 A G 8: 64,752,813 V358A probably damaging Het
Klk10 C G 7: 43,783,598 D139E probably damaging Het
Klk14 T C 7: 43,692,076 C51R probably damaging Het
Klk5 T G 7: 43,845,390 I99S probably damaging Het
L3hypdh T C 12: 72,077,393 T258A probably benign Het
Lrp5 A G 19: 3,614,292 Y812H probably damaging Het
Lrrc40 T A 3: 158,061,330 L474* probably null Het
Mkks A T 2: 136,880,655 M194K probably benign Het
Mmp20 A G 9: 7,654,120 D347G probably damaging Het
Mmp27 A G 9: 7,581,194 E460G probably damaging Het
Mms22l T C 4: 24,536,226 F605S probably damaging Het
Mpzl3 A G 9: 45,068,329 S193G probably benign Het
Muc4 A T 16: 32,751,747 T542S probably benign Het
Muc5b T C 7: 141,868,465 L4446P possibly damaging Het
Mxi1 C A 19: 53,370,338 S131* probably null Het
Nanog G T 6: 122,713,340 A210S probably benign Het
Nrcam C T 12: 44,575,986 Q988* probably null Het
Nsg1 C A 5: 38,159,047 probably benign Het
Ogfod3 G A 11: 121,195,201 A189V probably benign Het
Olfr1121 T A 2: 87,372,088 C185* probably null Het
Olfr1228 T C 2: 89,248,690 probably null Het
Olfr1240 A G 2: 89,439,865 V138A probably benign Het
Olfr1260 G A 2: 89,978,153 C125Y probably damaging Het
Olfr1465 A T 19: 13,314,320 probably null Het
Olfr548-ps1 T A 7: 102,542,380 V148E possibly damaging Het
Olfr58 T G 9: 19,783,576 S148A possibly damaging Het
Olfr632 T C 7: 103,937,503 V41A probably benign Het
Olfr920 A T 9: 38,756,407 T240S probably damaging Het
Olfr980 A T 9: 40,006,742 M69K possibly damaging Het
Orc3 A T 4: 34,571,774 M665K possibly damaging Het
Pabpc1 A G 15: 36,597,011 S591P probably damaging Het
Parp6 T A 9: 59,624,362 probably null Het
Pcdh1 T C 18: 38,189,859 M974V possibly damaging Het
Pcdhb22 T A 18: 37,520,660 V727E possibly damaging Het
Pex5l T C 3: 32,992,985 E272G probably damaging Het
Pglyrp2 G T 17: 32,418,261 N264K probably benign Het
Phxr4 T A 9: 13,431,586 probably benign Het
Piezo2 A G 18: 63,144,954 F293S probably damaging Het
Pkhd1 T C 1: 20,537,401 D1077G probably damaging Het
Plekhs1 A G 19: 56,473,268 probably null Het
Prex1 G T 2: 166,585,857 C788* probably null Het
Prrt3 A T 6: 113,498,138 M41K probably benign Het
Ptgir T C 7: 16,908,843 V326A probably damaging Het
Ptprg T A 14: 12,220,654 D455E probably damaging Het
Ptpru T A 4: 131,799,603 Q686L probably benign Het
Pxdc1 G T 13: 34,630,360 T190K probably benign Het
Rap1b A T 10: 117,818,582 C118S probably benign Het
Rapgef2 T C 3: 79,083,227 M915V probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpe65 C T 3: 159,624,681 A495V probably benign Het
Samd15 A G 12: 87,200,834 T98A possibly damaging Het
Sdk1 T G 5: 141,582,294 D82E probably benign Het
Slc26a7 T C 4: 14,546,309 D340G probably benign Het
Slc6a15 T A 10: 103,418,060 M619K probably benign Het
Slc7a4 C A 16: 17,574,521 D350Y probably damaging Het
Slk T G 19: 47,619,956 N449K probably benign Het
Spta1 A T 1: 174,244,042 probably null Het
Sptbn5 A T 2: 120,055,893 probably benign Het
Srd5a2 A T 17: 74,047,805 V8D probably benign Het
Srgap3 G A 6: 112,727,310 A906V probably benign Het
Stab2 A T 10: 86,947,147 M679K probably benign Het
Stk3 T C 15: 34,999,908 I291V probably benign Het
Supt6 T A 11: 78,208,134 Q1637L possibly damaging Het
Svil T C 18: 5,114,564 F2047S probably damaging Het
Swsap1 A G 9: 21,955,988 E76G probably benign Het
Syndig1 G T 2: 149,899,553 G20C probably damaging Het
Synj2bp A T 12: 81,502,152 N104K probably damaging Het
Synpo2 T A 3: 123,114,419 D416V probably damaging Het
Tacc3 G T 5: 33,672,013 C620F probably damaging Het
Tanc1 A G 2: 59,699,422 E19G probably damaging Het
Tarsl2 C T 7: 65,647,554 A139V probably benign Het
Tbc1d22a T A 15: 86,351,734 C365S probably damaging Het
Tdpoz2 T C 3: 93,652,074 H197R possibly damaging Het
Tha1 A T 11: 117,869,379 N300K probably damaging Het
Tm6sf1 T A 7: 81,865,260 F70L probably damaging Het
Tmem132b T A 5: 125,783,433 S581T probably benign Het
Tmem206 A T 1: 191,340,843 I154F probably damaging Het
Tnfsf13 G T 11: 69,685,249 S4* probably null Het
Tonsl G A 15: 76,633,248 S757L probably benign Het
Trem2 G T 17: 48,351,691 R161S possibly damaging Het
Trpm2 A T 10: 77,941,173 V430E probably damaging Het
Ttc14 T A 3: 33,801,369 D154E possibly damaging Het
Ugt2b37 T C 5: 87,250,639 M313V possibly damaging Het
Uhrf1bp1 G A 17: 27,877,394 A107T probably damaging Het
Vmn2r24 A G 6: 123,815,780 I689V probably benign Het
Wdr76 A G 2: 121,542,494 T601A probably benign Het
Xirp1 T C 9: 120,017,003 D938G possibly damaging Het
Zfp608 A T 18: 54,897,969 D966E probably benign Het
Zfp957 A G 14: 79,214,356 M1T probably null Het
Zkscan16 A T 4: 58,957,809 H697L possibly damaging Het
Other mutations in Glul
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Glul APN 1 153906476 missense probably benign 0.01
IGL02881:Glul APN 1 153907116 missense probably benign 0.00
R0512:Glul UTSW 1 153905386 intron probably benign
R1455:Glul UTSW 1 153907099 unclassified probably null
R1589:Glul UTSW 1 153905538 intron probably benign
R1922:Glul UTSW 1 153907324 missense probably benign 0.05
R2223:Glul UTSW 1 153906497 critical splice donor site probably null
R3115:Glul UTSW 1 153907292 missense possibly damaging 0.56
R4498:Glul UTSW 1 153907103 nonsense probably null
R4541:Glul UTSW 1 153903036 nonsense probably null
R4595:Glul UTSW 1 153903050 missense possibly damaging 0.95
R5714:Glul UTSW 1 153906497 unclassified probably benign
R6058:Glul UTSW 1 153907341 missense probably benign 0.03
R6101:Glul UTSW 1 153906431 nonsense probably null
R6105:Glul UTSW 1 153906431 nonsense probably null
R6517:Glul UTSW 1 153908033 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CCCTACAGTGGATCCCTTTG -3'
(R):5'- ACGCCAGAGTCCATCTAAAG -3'

Sequencing Primer
(F):5'- ACAGTGGATCCCTTTGAATTCG -3'
(R):5'- ATGCAGCAGCTTACTTACGG -3'
Posted On2016-03-01