Incidental Mutation 'R4825:Cep290'
ID371429
Institutional Source Beutler Lab
Gene Symbol Cep290
Ensembl Gene ENSMUSG00000019971
Gene Namecentrosomal protein 290
Synonymsb2b1454Clo, Nphp6, b2b1752Clo
MMRRC Submission 042441-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.907) question?
Stock #R4825 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location100487558-100574840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100488348 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 14 (D14E)
Ref Sequence ENSEMBL: ENSMUSP00000151712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058154] [ENSMUST00000099318] [ENSMUST00000128009] [ENSMUST00000134477] [ENSMUST00000164751] [ENSMUST00000219765] [ENSMUST00000220346]
Predicted Effect probably benign
Transcript: ENSMUST00000058154
SMART Domains Protein: ENSMUSP00000061470
Gene: ENSMUSG00000036676

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 98 120 N/A INTRINSIC
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 173 192 N/A INTRINSIC
transmembrane domain 205 227 N/A INTRINSIC
transmembrane domain 237 259 N/A INTRINSIC
Pfam:DUF1736 263 336 5.4e-35 PFAM
transmembrane domain 353 375 N/A INTRINSIC
transmembrane domain 382 399 N/A INTRINSIC
TPR 451 484 8.23e-6 SMART
TPR 485 518 2.13e1 SMART
TPR 533 567 8.77e1 SMART
TPR 568 601 3.19e-3 SMART
TPR 602 635 1.06e-8 SMART
TPR 673 706 1.35e-1 SMART
TPR 707 740 1.44e1 SMART
TPR 741 775 1.51e1 SMART
TPR 776 809 9e1 SMART
low complexity region 867 880 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099318
SMART Domains Protein: ENSMUSP00000096921
Gene: ENSMUSG00000036676

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 98 120 N/A INTRINSIC
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 173 192 N/A INTRINSIC
transmembrane domain 205 227 N/A INTRINSIC
transmembrane domain 237 259 N/A INTRINSIC
Pfam:DUF1736 261 338 2.6e-33 PFAM
transmembrane domain 353 375 N/A INTRINSIC
transmembrane domain 382 399 N/A INTRINSIC
TPR 451 484 8.23e-6 SMART
TPR 485 518 2.13e1 SMART
TPR 533 567 8.77e1 SMART
TPR 568 601 3.19e-3 SMART
TPR 602 635 1.06e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130883
Predicted Effect probably benign
Transcript: ENSMUST00000134477
Predicted Effect possibly damaging
Transcript: ENSMUST00000164751
AA Change: D14E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130899
Gene: ENSMUSG00000019971
AA Change: D14E

DomainStartEndE-ValueType
coiled coil region 59 298 N/A INTRINSIC
coiled coil region 319 566 N/A INTRINSIC
coiled coil region 598 662 N/A INTRINSIC
coiled coil region 697 754 N/A INTRINSIC
coiled coil region 780 875 N/A INTRINSIC
internal_repeat_2 884 894 1.1e-5 PROSPERO
coiled coil region 986 1028 N/A INTRINSIC
internal_repeat_2 1057 1067 1.1e-5 PROSPERO
coiled coil region 1071 1109 N/A INTRINSIC
low complexity region 1140 1156 N/A INTRINSIC
internal_repeat_1 1176 1206 8.72e-8 PROSPERO
coiled coil region 1221 1250 N/A INTRINSIC
Pfam:CEP209_CC5 1290 1417 3.8e-55 PFAM
low complexity region 1476 1493 N/A INTRINSIC
internal_repeat_1 1498 1525 8.72e-8 PROSPERO
coiled coil region 1535 1595 N/A INTRINSIC
coiled coil region 1624 1716 N/A INTRINSIC
coiled coil region 1776 2328 N/A INTRINSIC
low complexity region 2333 2347 N/A INTRINSIC
coiled coil region 2377 2453 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000219765
AA Change: D14E

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000220346
AA Change: D14E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 13 putative coiled-coil domains, a region with homology to SMC chromosome segregation ATPases, six KID motifs, three tropomyosin homology domains and an ATP/GTP binding site motif A. The protein is localized to the centrosome and cilia and has sites for N-glycosylation, tyrosine sulfation, phosphorylation, N-myristoylation, and amidation. Mutations in this gene have been associated with Joubert syndrome and nephronophthisis and the presence of antibodies against this protein is associated with several forms of cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice display mislocalization of ciliary and phototransduction proteins resulting in early-onset retinal degeneration. Heterotaxy with transposition of the great arteries (TGA), atrioventricular septal defect (AVSD), left bronchial isomerism, and hypoplastic spleen is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 130 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik C A 11: 109,791,672 L229F probably benign Het
A930002H24Rik A C 17: 63,863,608 S62A unknown Het
Abca12 T A 1: 71,302,685 Q1039L possibly damaging Het
Adgrg5 T A 8: 94,941,734 F476I possibly damaging Het
AI314180 G A 4: 58,850,911 L421F probably damaging Het
Alms1 A G 6: 85,678,245 K2789E probably damaging Het
Arrdc2 G A 8: 70,839,277 probably null Het
Atp2b1 T A 10: 99,009,564 I743K probably damaging Het
Atp6v1c2 C T 12: 17,289,060 G230D probably benign Het
AU040320 G A 4: 126,791,793 C54Y probably damaging Het
BC024139 C T 15: 76,120,317 V680I possibly damaging Het
Bckdhb A G 9: 83,988,905 D156G probably damaging Het
Canx T A 11: 50,308,809 D143V probably benign Het
Ccdc180 T A 4: 45,912,794 V591E possibly damaging Het
Ccno T C 13: 112,988,099 S68P probably benign Het
Cdc45 C T 16: 18,784,863 E527K probably damaging Het
Cgnl1 A G 9: 71,630,524 V1238A probably benign Het
Ciz1 C T 2: 32,371,741 A455V probably damaging Het
Coro2b T A 9: 62,454,623 Y86F probably benign Het
Csf2ra C T 19: 61,226,552 R158Q probably benign Het
Cubn A T 2: 13,325,225 I2615N probably damaging Het
Dhx8 C T 11: 101,738,170 R129* probably null Het
Disc1 T A 8: 125,135,302 M471K possibly damaging Het
Dmxl2 G T 9: 54,404,041 L1799I probably benign Het
Dnah2 A G 11: 69,423,205 S4108P probably damaging Het
Ehmt2 C G 17: 34,906,964 P211R probably benign Het
Eif4g3 A G 4: 138,194,081 D1557G probably benign Het
Epha5 T C 5: 84,233,840 D384G probably damaging Het
Etl4 A G 2: 20,806,927 I1274V probably damaging Het
Fam160a1 G A 3: 85,673,432 P489S possibly damaging Het
Fip1l1 G A 5: 74,588,205 probably null Het
Fubp1 T C 3: 152,217,890 probably null Het
Glul T C 1: 153,903,044 V33A probably benign Het
Gm4846 A G 1: 166,491,668 F167S probably damaging Het
Heatr6 T A 11: 83,758,322 L168M probably damaging Het
Hif1a T A 12: 73,932,401 I233N probably damaging Het
Hivep2 T A 10: 14,131,319 H1220Q possibly damaging Het
Igkv8-21 T C 6: 70,315,426 I9M probably benign Het
Izumo1 T A 7: 45,624,987 C62* probably null Het
Jakmip3 G A 7: 139,026,766 E424K probably damaging Het
Klhl2 A G 8: 64,752,813 V358A probably damaging Het
Klk10 C G 7: 43,783,598 D139E probably damaging Het
Klk14 T C 7: 43,692,076 C51R probably damaging Het
Klk5 T G 7: 43,845,390 I99S probably damaging Het
L3hypdh T C 12: 72,077,393 T258A probably benign Het
Lrp5 A G 19: 3,614,292 Y812H probably damaging Het
Lrrc40 T A 3: 158,061,330 L474* probably null Het
Mkks A T 2: 136,880,655 M194K probably benign Het
Mmp20 A G 9: 7,654,120 D347G probably damaging Het
Mmp27 A G 9: 7,581,194 E460G probably damaging Het
Mms22l T C 4: 24,536,226 F605S probably damaging Het
Mpzl3 A G 9: 45,068,329 S193G probably benign Het
Muc4 A T 16: 32,751,747 T542S probably benign Het
Muc5b T C 7: 141,868,465 L4446P possibly damaging Het
Mxi1 C A 19: 53,370,338 S131* probably null Het
Nanog G T 6: 122,713,340 A210S probably benign Het
Nrcam C T 12: 44,575,986 Q988* probably null Het
Nsg1 C A 5: 38,159,047 probably benign Het
Ogfod3 G A 11: 121,195,201 A189V probably benign Het
Olfr1121 T A 2: 87,372,088 C185* probably null Het
Olfr1228 T C 2: 89,248,690 probably null Het
Olfr1240 A G 2: 89,439,865 V138A probably benign Het
Olfr1260 G A 2: 89,978,153 C125Y probably damaging Het
Olfr1465 A T 19: 13,314,320 probably null Het
Olfr548-ps1 T A 7: 102,542,380 V148E possibly damaging Het
Olfr58 T G 9: 19,783,576 S148A possibly damaging Het
Olfr632 T C 7: 103,937,503 V41A probably benign Het
Olfr920 A T 9: 38,756,407 T240S probably damaging Het
Olfr980 A T 9: 40,006,742 M69K possibly damaging Het
Orc3 A T 4: 34,571,774 M665K possibly damaging Het
Pabpc1 A G 15: 36,597,011 S591P probably damaging Het
Parp6 T A 9: 59,624,362 probably null Het
Pcdh1 T C 18: 38,189,859 M974V possibly damaging Het
Pcdhb22 T A 18: 37,520,660 V727E possibly damaging Het
Pex5l T C 3: 32,992,985 E272G probably damaging Het
Pglyrp2 G T 17: 32,418,261 N264K probably benign Het
Phxr4 T A 9: 13,431,586 probably benign Het
Piezo2 A G 18: 63,144,954 F293S probably damaging Het
Pkhd1 T C 1: 20,537,401 D1077G probably damaging Het
Plekhs1 A G 19: 56,473,268 probably null Het
Prex1 G T 2: 166,585,857 C788* probably null Het
Prrt3 A T 6: 113,498,138 M41K probably benign Het
Ptgir T C 7: 16,908,843 V326A probably damaging Het
Ptprg T A 14: 12,220,654 D455E probably damaging Het
Ptpru T A 4: 131,799,603 Q686L probably benign Het
Pxdc1 G T 13: 34,630,360 T190K probably benign Het
Rap1b A T 10: 117,818,582 C118S probably benign Het
Rapgef2 T C 3: 79,083,227 M915V probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpe65 C T 3: 159,624,681 A495V probably benign Het
Samd15 A G 12: 87,200,834 T98A possibly damaging Het
Sdk1 T G 5: 141,582,294 D82E probably benign Het
Slc26a7 T C 4: 14,546,309 D340G probably benign Het
Slc6a15 T A 10: 103,418,060 M619K probably benign Het
Slc7a4 C A 16: 17,574,521 D350Y probably damaging Het
Slk T G 19: 47,619,956 N449K probably benign Het
Spta1 A T 1: 174,244,042 probably null Het
Sptbn5 A T 2: 120,055,893 probably benign Het
Srd5a2 A T 17: 74,047,805 V8D probably benign Het
Srgap3 G A 6: 112,727,310 A906V probably benign Het
Stab2 A T 10: 86,947,147 M679K probably benign Het
Stk3 T C 15: 34,999,908 I291V probably benign Het
Supt6 T A 11: 78,208,134 Q1637L possibly damaging Het
Svil T C 18: 5,114,564 F2047S probably damaging Het
Swsap1 A G 9: 21,955,988 E76G probably benign Het
Syndig1 G T 2: 149,899,553 G20C probably damaging Het
Synj2bp A T 12: 81,502,152 N104K probably damaging Het
Synpo2 T A 3: 123,114,419 D416V probably damaging Het
Tacc3 G T 5: 33,672,013 C620F probably damaging Het
Tanc1 A G 2: 59,699,422 E19G probably damaging Het
Tarsl2 C T 7: 65,647,554 A139V probably benign Het
Tbc1d22a T A 15: 86,351,734 C365S probably damaging Het
Tdpoz2 T C 3: 93,652,074 H197R possibly damaging Het
Tha1 A T 11: 117,869,379 N300K probably damaging Het
Tm6sf1 T A 7: 81,865,260 F70L probably damaging Het
Tmem132b T A 5: 125,783,433 S581T probably benign Het
Tmem206 A T 1: 191,340,843 I154F probably damaging Het
Tnfsf13 G T 11: 69,685,249 S4* probably null Het
Tonsl G A 15: 76,633,248 S757L probably benign Het
Trem2 G T 17: 48,351,691 R161S possibly damaging Het
Trpm2 A T 10: 77,941,173 V430E probably damaging Het
Ttc14 T A 3: 33,801,369 D154E possibly damaging Het
Ugt2b37 T C 5: 87,250,639 M313V possibly damaging Het
Uhrf1bp1 G A 17: 27,877,394 A107T probably damaging Het
Vmn2r24 A G 6: 123,815,780 I689V probably benign Het
Wdr76 A G 2: 121,542,494 T601A probably benign Het
Xirp1 T C 9: 120,017,003 D938G possibly damaging Het
Zfp608 A T 18: 54,897,969 D966E probably benign Het
Zfp957 A G 14: 79,214,356 M1T probably null Het
Zkscan16 A T 4: 58,957,809 H697L possibly damaging Het
Other mutations in Cep290
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Cep290 APN 10 100508724 missense probably benign 0.00
IGL00499:Cep290 APN 10 100543327 missense probably damaging 1.00
IGL00547:Cep290 APN 10 100510708 missense probably damaging 0.99
IGL00573:Cep290 APN 10 100540361 missense probably damaging 1.00
IGL00646:Cep290 APN 10 100501154 missense probably benign 0.15
IGL00755:Cep290 APN 10 100531104 missense probably damaging 1.00
IGL00835:Cep290 APN 10 100563380 nonsense probably null
IGL00846:Cep290 APN 10 100540333 splice site probably benign
IGL00985:Cep290 APN 10 100567161 splice site probably benign
IGL01687:Cep290 APN 10 100500205 missense probably damaging 1.00
IGL01782:Cep290 APN 10 100545125 nonsense probably null
IGL02010:Cep290 APN 10 100508707 missense probably benign 0.39
IGL02010:Cep290 APN 10 100561345 missense probably benign 0.00
IGL02036:Cep290 APN 10 100558100 nonsense probably null
IGL02039:Cep290 APN 10 100514602 critical splice donor site probably null
IGL02532:Cep290 APN 10 100545065 missense probably benign 0.04
IGL02950:Cep290 APN 10 100540329 splice site probably benign
IGL03105:Cep290 APN 10 100551824 missense possibly damaging 0.66
IGL03179:Cep290 APN 10 100568088 missense possibly damaging 0.60
IGL03271:Cep290 APN 10 100537801 missense probably benign 0.09
IGL03401:Cep290 APN 10 100500265 missense probably benign 0.27
PIT4687001:Cep290 UTSW 10 100537591 missense probably benign 0.28
R0025:Cep290 UTSW 10 100537831 missense probably damaging 1.00
R0127:Cep290 UTSW 10 100536925 splice site probably benign
R0254:Cep290 UTSW 10 100514574 missense probably benign 0.31
R0295:Cep290 UTSW 10 100537821 missense probably damaging 0.99
R0371:Cep290 UTSW 10 100518564 splice site probably benign
R0390:Cep290 UTSW 10 100508758 missense probably benign 0.09
R0399:Cep290 UTSW 10 100554400 splice site probably benign
R0413:Cep290 UTSW 10 100523314 nonsense probably null
R0427:Cep290 UTSW 10 100516179 missense probably benign 0.01
R0472:Cep290 UTSW 10 100551455 missense probably benign 0.19
R0485:Cep290 UTSW 10 100549344 missense possibly damaging 0.94
R0635:Cep290 UTSW 10 100492676 missense probably damaging 1.00
R0675:Cep290 UTSW 10 100568813 critical splice acceptor site probably null
R0972:Cep290 UTSW 10 100518762 missense probably benign 0.08
R1238:Cep290 UTSW 10 100517863 missense probably damaging 1.00
R1297:Cep290 UTSW 10 100539100 splice site probably benign
R1368:Cep290 UTSW 10 100494966 splice site probably benign
R1394:Cep290 UTSW 10 100537529 missense possibly damaging 0.66
R1437:Cep290 UTSW 10 100572101 missense probably benign 0.00
R1493:Cep290 UTSW 10 100562181 missense probably benign 0.21
R1496:Cep290 UTSW 10 100538966 missense probably damaging 1.00
R1539:Cep290 UTSW 10 100496828 missense probably benign 0.06
R1598:Cep290 UTSW 10 100549329 missense probably damaging 1.00
R1616:Cep290 UTSW 10 100568836 missense probably benign
R1712:Cep290 UTSW 10 100554499 missense probably benign 0.02
R1753:Cep290 UTSW 10 100513981 missense probably benign
R1773:Cep290 UTSW 10 100510573 missense probably benign
R1775:Cep290 UTSW 10 100496810 missense probably damaging 0.98
R1799:Cep290 UTSW 10 100516196 missense probably benign 0.00
R1937:Cep290 UTSW 10 100497953 missense possibly damaging 0.71
R1991:Cep290 UTSW 10 100531184 missense possibly damaging 0.80
R2031:Cep290 UTSW 10 100512400 critical splice donor site probably null
R2164:Cep290 UTSW 10 100518795 missense probably damaging 0.96
R2393:Cep290 UTSW 10 100561238 critical splice acceptor site probably null
R2403:Cep290 UTSW 10 100537437 missense probably benign 0.19
R3612:Cep290 UTSW 10 100541581 nonsense probably null
R3800:Cep290 UTSW 10 100572941 missense probably damaging 0.97
R4005:Cep290 UTSW 10 100539008 missense probably damaging 1.00
R4039:Cep290 UTSW 10 100512401 critical splice donor site probably null
R4259:Cep290 UTSW 10 100514492 missense probably damaging 1.00
R4260:Cep290 UTSW 10 100514492 missense probably damaging 1.00
R4319:Cep290 UTSW 10 100539047 missense probably benign 0.09
R4329:Cep290 UTSW 10 100537668 missense probably damaging 0.98
R4573:Cep290 UTSW 10 100518850 missense probably benign
R4614:Cep290 UTSW 10 100508740 missense probably benign
R4614:Cep290 UTSW 10 100559687 missense possibly damaging 0.93
R4708:Cep290 UTSW 10 100523264 missense probably benign 0.02
R4727:Cep290 UTSW 10 100563270 missense probably benign 0.05
R4839:Cep290 UTSW 10 100508786 missense probably damaging 0.99
R4858:Cep290 UTSW 10 100494911 missense probably benign 0.31
R4871:Cep290 UTSW 10 100548914 missense probably benign 0.22
R5094:Cep290 UTSW 10 100567030 missense probably damaging 0.97
R5103:Cep290 UTSW 10 100539020 missense probably damaging 1.00
R5499:Cep290 UTSW 10 100537653 missense probably damaging 0.99
R5505:Cep290 UTSW 10 100499186 critical splice donor site probably null
R5615:Cep290 UTSW 10 100531150 missense probably damaging 1.00
R5815:Cep290 UTSW 10 100558108 missense possibly damaging 0.80
R5883:Cep290 UTSW 10 100523399 missense probably benign 0.44
R5889:Cep290 UTSW 10 100499074 missense possibly damaging 0.95
R5928:Cep290 UTSW 10 100551830 missense probably damaging 0.99
R5992:Cep290 UTSW 10 100543321 missense possibly damaging 0.73
R6000:Cep290 UTSW 10 100541787 missense probably damaging 1.00
R6213:Cep290 UTSW 10 100523360 missense probably benign 0.06
R6274:Cep290 UTSW 10 100530207 missense probably damaging 1.00
R6285:Cep290 UTSW 10 100523329 missense probably benign 0.17
R6306:Cep290 UTSW 10 100531166 missense possibly damaging 0.89
R6593:Cep290 UTSW 10 100508776 missense probably benign 0.01
R6649:Cep290 UTSW 10 100518531 missense probably benign 0.28
R6692:Cep290 UTSW 10 100569144 intron probably null
R6788:Cep290 UTSW 10 100488628 missense probably damaging 1.00
R6847:Cep290 UTSW 10 100563419 missense probably damaging 1.00
R6947:Cep290 UTSW 10 100530056 missense probably damaging 1.00
R7035:Cep290 UTSW 10 100499071 missense probably benign 0.07
R7073:Cep290 UTSW 10 100539003 missense possibly damaging 0.90
R7114:Cep290 UTSW 10 100543358 missense probably damaging 0.98
R7256:Cep290 UTSW 10 100546498 missense probably damaging 1.00
R7258:Cep290 UTSW 10 100499108 missense probably benign 0.01
R7311:Cep290 UTSW 10 100537718 missense probably damaging 0.98
R7505:Cep290 UTSW 10 100516265 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAACTAATTTTCGTCGAGGCTG -3'
(R):5'- TGGACTATTTCATACCCTGCAC -3'

Sequencing Primer
(F):5'- TTGCAGTTCAGGAGCCATAGC -3'
(R):5'- TGCACATTAAATACAAGCACTCTTC -3'
Posted On2016-03-01