Incidental Mutation 'R4825:BC024139'
ID371459
Institutional Source Beutler Lab
Gene Symbol BC024139
Ensembl Gene ENSMUSG00000044361
Gene NamecDNA sequence BC024139
Synonyms6230424I18Rik
MMRRC Submission 042441-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R4825 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location76119517-76126596 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 76120317 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 680 (V680I)
Ref Sequence ENSEMBL: ENSMUSP00000087082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054022] [ENSMUST00000089654] [ENSMUST00000146157] [ENSMUST00000226781]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054022
AA Change: V680I

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000053305
Gene: ENSMUSG00000044361
AA Change: V680I

DomainStartEndE-ValueType
low complexity region 61 79 N/A INTRINSIC
SPEC 91 177 8.82e-1 SMART
SPEC 184 283 2.74e-2 SMART
coiled coil region 314 337 N/A INTRINSIC
low complexity region 469 485 N/A INTRINSIC
Pfam:GAS2 672 701 3.9e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000089654
AA Change: V680I

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000087082
Gene: ENSMUSG00000044361
AA Change: V680I

DomainStartEndE-ValueType
low complexity region 61 79 N/A INTRINSIC
SPEC 91 177 8.82e-1 SMART
SPEC 184 283 2.74e-2 SMART
coiled coil region 314 337 N/A INTRINSIC
low complexity region 469 485 N/A INTRINSIC
Pfam:GAS2 671 703 3.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126892
Predicted Effect probably benign
Transcript: ENSMUST00000146157
SMART Domains Protein: ENSMUSP00000117783
Gene: ENSMUSG00000044361

DomainStartEndE-ValueType
low complexity region 61 79 N/A INTRINSIC
SPEC 91 177 8.82e-1 SMART
SPEC 184 283 2.74e-2 SMART
coiled coil region 314 337 N/A INTRINSIC
low complexity region 469 485 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226663
Predicted Effect probably benign
Transcript: ENSMUST00000226781
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 130 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik C A 11: 109,791,672 L229F probably benign Het
A930002H24Rik A C 17: 63,863,608 S62A unknown Het
Abca12 T A 1: 71,302,685 Q1039L possibly damaging Het
Adgrg5 T A 8: 94,941,734 F476I possibly damaging Het
AI314180 G A 4: 58,850,911 L421F probably damaging Het
Alms1 A G 6: 85,678,245 K2789E probably damaging Het
Arrdc2 G A 8: 70,839,277 probably null Het
Atp2b1 T A 10: 99,009,564 I743K probably damaging Het
Atp6v1c2 C T 12: 17,289,060 G230D probably benign Het
AU040320 G A 4: 126,791,793 C54Y probably damaging Het
Bckdhb A G 9: 83,988,905 D156G probably damaging Het
Canx T A 11: 50,308,809 D143V probably benign Het
Ccdc180 T A 4: 45,912,794 V591E possibly damaging Het
Ccno T C 13: 112,988,099 S68P probably benign Het
Cdc45 C T 16: 18,784,863 E527K probably damaging Het
Cep290 T A 10: 100,488,348 D14E probably damaging Het
Cgnl1 A G 9: 71,630,524 V1238A probably benign Het
Ciz1 C T 2: 32,371,741 A455V probably damaging Het
Coro2b T A 9: 62,454,623 Y86F probably benign Het
Csf2ra C T 19: 61,226,552 R158Q probably benign Het
Cubn A T 2: 13,325,225 I2615N probably damaging Het
Dhx8 C T 11: 101,738,170 R129* probably null Het
Disc1 T A 8: 125,135,302 M471K possibly damaging Het
Dmxl2 G T 9: 54,404,041 L1799I probably benign Het
Dnah2 A G 11: 69,423,205 S4108P probably damaging Het
Ehmt2 C G 17: 34,906,964 P211R probably benign Het
Eif4g3 A G 4: 138,194,081 D1557G probably benign Het
Epha5 T C 5: 84,233,840 D384G probably damaging Het
Etl4 A G 2: 20,806,927 I1274V probably damaging Het
Fam160a1 G A 3: 85,673,432 P489S possibly damaging Het
Fip1l1 G A 5: 74,588,205 probably null Het
Fubp1 T C 3: 152,217,890 probably null Het
Glul T C 1: 153,903,044 V33A probably benign Het
Gm4846 A G 1: 166,491,668 F167S probably damaging Het
Heatr6 T A 11: 83,758,322 L168M probably damaging Het
Hif1a T A 12: 73,932,401 I233N probably damaging Het
Hivep2 T A 10: 14,131,319 H1220Q possibly damaging Het
Igkv8-21 T C 6: 70,315,426 I9M probably benign Het
Izumo1 T A 7: 45,624,987 C62* probably null Het
Jakmip3 G A 7: 139,026,766 E424K probably damaging Het
Klhl2 A G 8: 64,752,813 V358A probably damaging Het
Klk10 C G 7: 43,783,598 D139E probably damaging Het
Klk14 T C 7: 43,692,076 C51R probably damaging Het
Klk5 T G 7: 43,845,390 I99S probably damaging Het
L3hypdh T C 12: 72,077,393 T258A probably benign Het
Lrp5 A G 19: 3,614,292 Y812H probably damaging Het
Lrrc40 T A 3: 158,061,330 L474* probably null Het
Mkks A T 2: 136,880,655 M194K probably benign Het
Mmp20 A G 9: 7,654,120 D347G probably damaging Het
Mmp27 A G 9: 7,581,194 E460G probably damaging Het
Mms22l T C 4: 24,536,226 F605S probably damaging Het
Mpzl3 A G 9: 45,068,329 S193G probably benign Het
Muc4 A T 16: 32,751,747 T542S probably benign Het
Muc5b T C 7: 141,868,465 L4446P possibly damaging Het
Mxi1 C A 19: 53,370,338 S131* probably null Het
Nanog G T 6: 122,713,340 A210S probably benign Het
Nrcam C T 12: 44,575,986 Q988* probably null Het
Nsg1 C A 5: 38,159,047 probably benign Het
Ogfod3 G A 11: 121,195,201 A189V probably benign Het
Olfr1121 T A 2: 87,372,088 C185* probably null Het
Olfr1228 T C 2: 89,248,690 probably null Het
Olfr1240 A G 2: 89,439,865 V138A probably benign Het
Olfr1260 G A 2: 89,978,153 C125Y probably damaging Het
Olfr1465 A T 19: 13,314,320 probably null Het
Olfr548-ps1 T A 7: 102,542,380 V148E possibly damaging Het
Olfr58 T G 9: 19,783,576 S148A possibly damaging Het
Olfr632 T C 7: 103,937,503 V41A probably benign Het
Olfr920 A T 9: 38,756,407 T240S probably damaging Het
Olfr980 A T 9: 40,006,742 M69K possibly damaging Het
Orc3 A T 4: 34,571,774 M665K possibly damaging Het
Pabpc1 A G 15: 36,597,011 S591P probably damaging Het
Parp6 T A 9: 59,624,362 probably null Het
Pcdh1 T C 18: 38,189,859 M974V possibly damaging Het
Pcdhb22 T A 18: 37,520,660 V727E possibly damaging Het
Pex5l T C 3: 32,992,985 E272G probably damaging Het
Pglyrp2 G T 17: 32,418,261 N264K probably benign Het
Phxr4 T A 9: 13,431,586 probably benign Het
Piezo2 A G 18: 63,144,954 F293S probably damaging Het
Pkhd1 T C 1: 20,537,401 D1077G probably damaging Het
Plekhs1 A G 19: 56,473,268 probably null Het
Prex1 G T 2: 166,585,857 C788* probably null Het
Prrt3 A T 6: 113,498,138 M41K probably benign Het
Ptgir T C 7: 16,908,843 V326A probably damaging Het
Ptprg T A 14: 12,220,654 D455E probably damaging Het
Ptpru T A 4: 131,799,603 Q686L probably benign Het
Pxdc1 G T 13: 34,630,360 T190K probably benign Het
Rap1b A T 10: 117,818,582 C118S probably benign Het
Rapgef2 T C 3: 79,083,227 M915V probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpe65 C T 3: 159,624,681 A495V probably benign Het
Samd15 A G 12: 87,200,834 T98A possibly damaging Het
Sdk1 T G 5: 141,582,294 D82E probably benign Het
Slc26a7 T C 4: 14,546,309 D340G probably benign Het
Slc6a15 T A 10: 103,418,060 M619K probably benign Het
Slc7a4 C A 16: 17,574,521 D350Y probably damaging Het
Slk T G 19: 47,619,956 N449K probably benign Het
Spta1 A T 1: 174,244,042 probably null Het
Sptbn5 A T 2: 120,055,893 probably benign Het
Srd5a2 A T 17: 74,047,805 V8D probably benign Het
Srgap3 G A 6: 112,727,310 A906V probably benign Het
Stab2 A T 10: 86,947,147 M679K probably benign Het
Stk3 T C 15: 34,999,908 I291V probably benign Het
Supt6 T A 11: 78,208,134 Q1637L possibly damaging Het
Svil T C 18: 5,114,564 F2047S probably damaging Het
Swsap1 A G 9: 21,955,988 E76G probably benign Het
Syndig1 G T 2: 149,899,553 G20C probably damaging Het
Synj2bp A T 12: 81,502,152 N104K probably damaging Het
Synpo2 T A 3: 123,114,419 D416V probably damaging Het
Tacc3 G T 5: 33,672,013 C620F probably damaging Het
Tanc1 A G 2: 59,699,422 E19G probably damaging Het
Tarsl2 C T 7: 65,647,554 A139V probably benign Het
Tbc1d22a T A 15: 86,351,734 C365S probably damaging Het
Tdpoz2 T C 3: 93,652,074 H197R possibly damaging Het
Tha1 A T 11: 117,869,379 N300K probably damaging Het
Tm6sf1 T A 7: 81,865,260 F70L probably damaging Het
Tmem132b T A 5: 125,783,433 S581T probably benign Het
Tmem206 A T 1: 191,340,843 I154F probably damaging Het
Tnfsf13 G T 11: 69,685,249 S4* probably null Het
Tonsl G A 15: 76,633,248 S757L probably benign Het
Trem2 G T 17: 48,351,691 R161S possibly damaging Het
Trpm2 A T 10: 77,941,173 V430E probably damaging Het
Ttc14 T A 3: 33,801,369 D154E possibly damaging Het
Ugt2b37 T C 5: 87,250,639 M313V possibly damaging Het
Uhrf1bp1 G A 17: 27,877,394 A107T probably damaging Het
Vmn2r24 A G 6: 123,815,780 I689V probably benign Het
Wdr76 A G 2: 121,542,494 T601A probably benign Het
Xirp1 T C 9: 120,017,003 D938G possibly damaging Het
Zfp608 A T 18: 54,897,969 D966E probably benign Het
Zfp957 A G 14: 79,214,356 M1T probably null Het
Zkscan16 A T 4: 58,957,809 H697L possibly damaging Het
Other mutations in BC024139
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:BC024139 APN 15 76125100 missense probably benign 0.06
IGL01684:BC024139 APN 15 76124685 missense probably damaging 1.00
IGL01780:BC024139 APN 15 76121143 missense probably benign 0.01
IGL03084:BC024139 APN 15 76119807 missense probably benign 0.00
IGL03242:BC024139 APN 15 76120320 missense probably benign 0.32
IGL03386:BC024139 APN 15 76121745 missense probably benign 0.18
R0018:BC024139 UTSW 15 76120887 nonsense probably null
R0018:BC024139 UTSW 15 76120887 nonsense probably null
R0153:BC024139 UTSW 15 76121747 missense probably damaging 0.96
R0789:BC024139 UTSW 15 76121083 missense possibly damaging 0.51
R1158:BC024139 UTSW 15 76120342 unclassified probably benign
R1515:BC024139 UTSW 15 76124326 missense possibly damaging 0.83
R1840:BC024139 UTSW 15 76120642 missense probably benign
R1845:BC024139 UTSW 15 76125261 nonsense probably null
R2159:BC024139 UTSW 15 76121488 missense probably damaging 0.96
R2264:BC024139 UTSW 15 76125917 missense probably damaging 1.00
R2680:BC024139 UTSW 15 76121739 missense probably damaging 0.98
R2697:BC024139 UTSW 15 76120193 unclassified probably benign
R4113:BC024139 UTSW 15 76121627 missense probably benign 0.35
R4630:BC024139 UTSW 15 76125094 missense probably benign 0.23
R4865:BC024139 UTSW 15 76126066 missense possibly damaging 0.56
R5208:BC024139 UTSW 15 76124665 missense probably benign 0.03
R5369:BC024139 UTSW 15 76120222 missense probably benign 0.02
R5371:BC024139 UTSW 15 76120686 makesense probably null
R5897:BC024139 UTSW 15 76126139 missense possibly damaging 0.84
R6110:BC024139 UTSW 15 76119796 missense probably benign
R6374:BC024139 UTSW 15 76120457 critical splice donor site probably null
R6823:BC024139 UTSW 15 76119746 makesense probably null
R6915:BC024139 UTSW 15 76120021 missense probably benign
X0066:BC024139 UTSW 15 76124002 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTTGCTGCTCAGAGATCCC -3'
(R):5'- GTGGTCAGAGCAAGAAACCC -3'

Sequencing Primer
(F):5'- TCAGAGATCCCATGTCGCTAG -3'
(R):5'- CCAGAAGGGTCAAGTGCATC -3'
Posted On2016-03-01