Incidental Mutation 'R4838:Erich6'
ID371499
Institutional Source Beutler Lab
Gene Symbol Erich6
Ensembl Gene ENSMUSG00000070471
Gene Nameglutamate rich 6
SynonymsFam194a, 4932431H17Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4838 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location58616300-58637207 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58636830 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 112 (I112T)
Ref Sequence ENSEMBL: ENSMUSP00000040882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041115]
Predicted Effect probably benign
Transcript: ENSMUST00000041115
AA Change: I112T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000040882
Gene: ENSMUSG00000070471
AA Change: I112T

DomainStartEndE-ValueType
coiled coil region 27 77 N/A INTRINSIC
low complexity region 164 174 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
Pfam:FAM194 473 675 5.4e-67 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A T 9: 22,424,377 D97V probably damaging Het
Abca15 T C 7: 120,345,300 V386A probably benign Het
Adk G A 14: 21,369,086 A247T probably damaging Het
Ankrd27 T A 7: 35,591,806 L9Q possibly damaging Het
Atad2 A G 15: 58,103,283 L638P probably damaging Het
Atf7ip T A 6: 136,596,491 D1009E probably benign Het
Bend7 A T 2: 4,744,322 K83N probably damaging Het
Bicc1 C T 10: 70,945,316 D562N possibly damaging Het
Calcrl T A 2: 84,351,205 N200Y probably damaging Het
Ccdc125 C A 13: 100,677,945 A11E possibly damaging Het
Cd5l A G 3: 87,365,951 T76A probably benign Het
Cdhr5 A T 7: 141,273,731 I2N probably damaging Het
Cdk10 C T 8: 123,230,614 A230V probably damaging Het
Cep128 T C 12: 90,999,545 probably benign Het
Cep131 T C 11: 120,076,156 N186D probably damaging Het
Cog7 G T 7: 121,971,381 P168Q probably damaging Het
Col28a1 T A 6: 8,014,559 M949L probably benign Het
Coq8b T A 7: 27,250,591 M365K probably damaging Het
Cpa1 A G 6: 30,639,516 E18G possibly damaging Het
Csmd2 A G 4: 128,517,749 H2520R probably benign Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Dpm1 G A 2: 168,210,536 T260I probably damaging Het
Dtx3 A T 10: 127,191,307 probably null Het
Eepd1 T C 9: 25,589,460 V401A possibly damaging Het
Ehhadh A G 16: 21,763,202 S347P possibly damaging Het
Elp3 A G 14: 65,547,864 probably null Het
Enam C T 5: 88,493,108 Q210* probably null Het
Epha1 C T 6: 42,363,816 R607H probably benign Het
F830045P16Rik A G 2: 129,460,550 V374A possibly damaging Het
Fam171a2 C A 11: 102,438,685 R416L possibly damaging Het
Fam35a A G 14: 34,268,625 V108A probably benign Het
Fbn1 T C 2: 125,372,399 N764S probably benign Het
Fip1l1 C T 5: 74,591,939 T469I probably damaging Het
Flad1 G A 3: 89,405,910 R342C probably damaging Het
Fzd3 A G 14: 65,239,820 V95A probably benign Het
Garem1 T C 18: 21,147,893 T469A probably benign Het
Gm13084 G A 4: 143,810,805 Q319* probably null Het
Gm17093 A G 14: 44,518,348 Y24C unknown Het
Gm4788 T A 1: 139,733,443 D556V probably damaging Het
Gm7534 A G 4: 134,193,099 V585A probably benign Het
Grap2 T C 15: 80,638,561 V96A possibly damaging Het
Greb1 A T 12: 16,684,360 probably null Het
Grid2ip A T 5: 143,388,775 K913* probably null Het
Gzmk T C 13: 113,173,021 D126G probably damaging Het
Hibch A G 1: 52,885,178 I171V possibly damaging Het
Hipk2 G T 6: 38,818,404 T310K possibly damaging Het
Hk3 T C 13: 55,006,418 Y815C probably damaging Het
Hps5 A T 7: 46,788,354 V99E probably damaging Het
Hspg2 A G 4: 137,541,666 H2203R possibly damaging Het
Il12rb2 A G 6: 67,309,137 V108A probably damaging Het
Il6st C T 13: 112,490,510 R279* probably null Het
Kdm2a A C 19: 4,325,026 S692R probably benign Het
Kif13a T C 13: 46,826,748 K176R probably damaging Het
Kif5b T C 18: 6,216,869 K485E probably damaging Het
Ktn1 C T 14: 47,725,956 R1111* probably null Het
Lrrc23 A T 6: 124,778,189 N128K probably benign Het
Mad1l1 G A 5: 140,300,262 Q293* probably null Het
Man1b1 A T 2: 25,345,475 I338F possibly damaging Het
March1 G T 8: 66,468,363 V225L probably damaging Het
Mrpl3 A G 9: 105,057,032 D118G probably damaging Het
Nomo1 A T 7: 46,083,715 Q1209L unknown Het
Nrcam A G 12: 44,574,019 E949G probably damaging Het
Olfm5 T G 7: 104,154,365 N297T probably damaging Het
Olfr573-ps1 T A 7: 102,942,246 L110F probably damaging Het
Pcdh7 A T 5: 57,720,804 N567I probably damaging Het
Pkn1 A G 8: 83,677,966 L495P probably damaging Het
Pkp1 T C 1: 135,882,588 S415G probably damaging Het
Pou2f1 T A 1: 165,916,923 Q53L probably null Het
Prkce A G 17: 86,630,083 K648R probably benign Het
Ptprh G A 7: 4,573,430 T277I possibly damaging Het
Rpl31 C T 1: 39,370,967 R83C probably benign Het
Rpusd3 G A 6: 113,416,876 Q194* probably null Het
Sgsm1 T A 5: 113,282,626 N298Y probably damaging Het
She G A 3: 89,851,639 G355D probably benign Het
Snx11 C T 11: 96,774,458 E9K possibly damaging Het
Soat1 C A 1: 156,432,937 A444S probably benign Het
Sox6 T C 7: 115,486,662 Y690C probably damaging Het
Spata13 T A 14: 60,733,179 F10I probably benign Het
St18 C A 1: 6,802,905 T288K probably benign Het
Tifa C T 3: 127,796,586 S2F probably damaging Het
Tmem232 A T 17: 65,430,888 S392R probably benign Het
Tmtc3 T C 10: 100,466,220 N289S probably damaging Het
Tpo A G 12: 30,092,634 F697S probably damaging Het
Trp53 A G 11: 69,587,630 T122A probably damaging Het
Trps1 A C 15: 50,827,316 I10S probably benign Het
Tubgcp5 C T 7: 55,794,185 probably benign Het
Unc13c T G 9: 73,932,072 Y499S possibly damaging Het
Unc45a C A 7: 80,333,035 D381Y probably damaging Het
Upf1 G C 8: 70,339,368 H402Q probably benign Het
Uroc1 A T 6: 90,349,192 I510F possibly damaging Het
Usp15 A G 10: 123,127,757 F589L probably damaging Het
Vmn2r76 T C 7: 86,225,525 Y748C probably damaging Het
Wwp1 T C 4: 19,662,143 N151D probably benign Het
Zbtb40 A T 4: 137,001,216 S439T probably benign Het
Zbtb6 A T 2: 37,428,716 L400* probably null Het
Zfp125 C T 12: 20,899,960 noncoding transcript Het
Zmynd8 A C 2: 165,840,034 Y183* probably null Het
Other mutations in Erich6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Erich6 APN 3 58637043 missense unknown
IGL01352:Erich6 APN 3 58622360 splice site probably null
IGL01362:Erich6 APN 3 58622360 splice site probably null
IGL01928:Erich6 APN 3 58621271 missense probably damaging 1.00
IGL02930:Erich6 APN 3 58622354 splice site probably benign
IGL03125:Erich6 APN 3 58624306 missense probably benign 0.00
PIT4243001:Erich6 UTSW 3 58629879 missense possibly damaging 0.51
R0081:Erich6 UTSW 3 58636126 splice site probably benign
R0129:Erich6 UTSW 3 58624378 missense probably damaging 1.00
R0308:Erich6 UTSW 3 58636104 missense probably damaging 1.00
R0682:Erich6 UTSW 3 58636811 missense probably benign 0.39
R0734:Erich6 UTSW 3 58629388 splice site probably benign
R0744:Erich6 UTSW 3 58636122 splice site probably benign
R0833:Erich6 UTSW 3 58618944 splice site probably benign
R0836:Erich6 UTSW 3 58618944 splice site probably benign
R1385:Erich6 UTSW 3 58636830 missense probably benign 0.00
R1536:Erich6 UTSW 3 58626598 missense probably benign 0.01
R1570:Erich6 UTSW 3 58630659 critical splice donor site probably null
R1708:Erich6 UTSW 3 58616447 missense probably benign 0.21
R2187:Erich6 UTSW 3 58629845 critical splice donor site probably null
R2268:Erich6 UTSW 3 58618839 missense probably benign 0.03
R2441:Erich6 UTSW 3 58618811 missense probably damaging 1.00
R3803:Erich6 UTSW 3 58621332 missense probably damaging 1.00
R3981:Erich6 UTSW 3 58636704 missense probably benign 0.41
R4166:Erich6 UTSW 3 58618808 missense probably damaging 1.00
R4298:Erich6 UTSW 3 58624291 missense probably benign 0.09
R4729:Erich6 UTSW 3 58636059 critical splice donor site probably null
R5117:Erich6 UTSW 3 58623205 missense probably benign 0.00
R5305:Erich6 UTSW 3 58625116 missense probably benign 0.21
R5546:Erich6 UTSW 3 58618797 missense probably benign 0.39
R5605:Erich6 UTSW 3 58625119 missense probably damaging 1.00
R6033:Erich6 UTSW 3 58623201 missense probably benign 0.16
R6033:Erich6 UTSW 3 58623201 missense probably benign 0.16
R6378:Erich6 UTSW 3 58622359 splice site probably null
R6606:Erich6 UTSW 3 58616500 missense probably damaging 1.00
R6736:Erich6 UTSW 3 58625054 missense probably damaging 1.00
R6746:Erich6 UTSW 3 58616566 missense possibly damaging 0.69
R6974:Erich6 UTSW 3 58618799 missense probably benign 0.06
R6996:Erich6 UTSW 3 58636095 missense probably damaging 1.00
R7317:Erich6 UTSW 3 58636884 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- CCAACGCTACTTTTGTGGGAC -3'
(R):5'- AGACAGACGCTCAACAGCTG -3'

Sequencing Primer
(F):5'- CTACTTTTGTGGGACGAGCC -3'
(R):5'- GGGCTGCCCACAAACATG -3'
Posted On2016-03-01