Incidental Mutation 'R4838:Fip1l1'
ID371512
Institutional Source Beutler Lab
Gene Symbol Fip1l1
Ensembl Gene ENSMUSG00000029227
Gene NameFIP1 like 1 (S. cerevisiae)
Synonyms1300019H17Rik, Rje
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R4838 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location74535449-74598800 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 74591939 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 469 (T469I)
Ref Sequence ENSEMBL: ENSMUSP00000109164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039744] [ENSMUST00000080164] [ENSMUST00000087161] [ENSMUST00000113531] [ENSMUST00000113534] [ENSMUST00000113535] [ENSMUST00000113536] [ENSMUST00000120618] [ENSMUST00000127396]
Predicted Effect probably benign
Transcript: ENSMUST00000039744
SMART Domains Protein: ENSMUSP00000040098
Gene: ENSMUSG00000029228

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
Blast:PDZ 57 164 1e-33 BLAST
PDZ 188 263 5.33e-19 SMART
PDZ 295 368 2.27e-13 SMART
PDZ 417 494 8.27e-16 SMART
PDZ 547 624 5.71e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080164
AA Change: T433I

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000079059
Gene: ENSMUSG00000029227
AA Change: T433I

DomainStartEndE-ValueType
low complexity region 44 53 N/A INTRINSIC
low complexity region 78 94 N/A INTRINSIC
Pfam:Fip1 152 196 1.2e-28 PFAM
low complexity region 296 357 N/A INTRINSIC
low complexity region 405 441 N/A INTRINSIC
low complexity region 453 507 N/A INTRINSIC
low complexity region 510 523 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087161
SMART Domains Protein: ENSMUSP00000084405
Gene: ENSMUSG00000029228

DomainStartEndE-ValueType
RING 45 82 5.82e-6 SMART
low complexity region 97 107 N/A INTRINSIC
Blast:PDZ 157 264 3e-33 BLAST
PDZ 288 363 5.33e-19 SMART
PDZ 395 468 2.27e-13 SMART
PDZ 517 594 8.27e-16 SMART
PDZ 647 724 5.71e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113531
SMART Domains Protein: ENSMUSP00000109159
Gene: ENSMUSG00000029228

DomainStartEndE-ValueType
Blast:PDZ 2 105 2e-32 BLAST
PDZ 129 204 5.33e-19 SMART
PDZ 236 309 2.27e-13 SMART
PDZ 358 435 8.27e-16 SMART
PDZ 488 565 5.71e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113534
AA Change: T483I

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109162
Gene: ENSMUSG00000029227
AA Change: T483I

DomainStartEndE-ValueType
low complexity region 44 53 N/A INTRINSIC
low complexity region 78 94 N/A INTRINSIC
Pfam:Fip1 152 196 1.1e-28 PFAM
low complexity region 270 290 N/A INTRINSIC
low complexity region 355 405 N/A INTRINSIC
low complexity region 455 491 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113535
AA Change: T424I

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109163
Gene: ENSMUSG00000029227
AA Change: T424I

DomainStartEndE-ValueType
low complexity region 44 53 N/A INTRINSIC
low complexity region 78 94 N/A INTRINSIC
Pfam:Fip1 152 196 6.4e-29 PFAM
low complexity region 296 346 N/A INTRINSIC
low complexity region 396 432 N/A INTRINSIC
low complexity region 444 498 N/A INTRINSIC
low complexity region 501 514 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113536
AA Change: T469I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109164
Gene: ENSMUSG00000029227
AA Change: T469I

DomainStartEndE-ValueType
low complexity region 44 53 N/A INTRINSIC
low complexity region 78 94 N/A INTRINSIC
Pfam:Fip1 152 196 1.3e-28 PFAM
low complexity region 247 267 N/A INTRINSIC
low complexity region 332 393 N/A INTRINSIC
low complexity region 441 477 N/A INTRINSIC
low complexity region 489 543 N/A INTRINSIC
low complexity region 546 559 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120618
SMART Domains Protein: ENSMUSP00000113995
Gene: ENSMUSG00000029227

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
low complexity region 63 79 N/A INTRINSIC
Pfam:Fip1 137 181 2e-29 PFAM
low complexity region 255 275 N/A INTRINSIC
low complexity region 340 401 N/A INTRINSIC
low complexity region 449 485 N/A INTRINSIC
low complexity region 497 551 N/A INTRINSIC
low complexity region 554 567 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121950
AA Change: T483I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113611
Gene: ENSMUSG00000029227
AA Change: T483I

DomainStartEndE-ValueType
low complexity region 44 53 N/A INTRINSIC
low complexity region 78 94 N/A INTRINSIC
Pfam:Fip1 153 195 6.6e-29 PFAM
low complexity region 270 290 N/A INTRINSIC
low complexity region 355 405 N/A INTRINSIC
low complexity region 455 491 N/A INTRINSIC
low complexity region 503 557 N/A INTRINSIC
low complexity region 560 573 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125129
Predicted Effect probably benign
Transcript: ENSMUST00000127396
SMART Domains Protein: ENSMUSP00000120886
Gene: ENSMUSG00000029228

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201310
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202499
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A T 9: 22,424,377 D97V probably damaging Het
Abca15 T C 7: 120,345,300 V386A probably benign Het
Adk G A 14: 21,369,086 A247T probably damaging Het
Ankrd27 T A 7: 35,591,806 L9Q possibly damaging Het
Atad2 A G 15: 58,103,283 L638P probably damaging Het
Atf7ip T A 6: 136,596,491 D1009E probably benign Het
Bend7 A T 2: 4,744,322 K83N probably damaging Het
Bicc1 C T 10: 70,945,316 D562N possibly damaging Het
Calcrl T A 2: 84,351,205 N200Y probably damaging Het
Ccdc125 C A 13: 100,677,945 A11E possibly damaging Het
Cd5l A G 3: 87,365,951 T76A probably benign Het
Cdhr5 A T 7: 141,273,731 I2N probably damaging Het
Cdk10 C T 8: 123,230,614 A230V probably damaging Het
Cep128 T C 12: 90,999,545 probably benign Het
Cep131 T C 11: 120,076,156 N186D probably damaging Het
Cog7 G T 7: 121,971,381 P168Q probably damaging Het
Col28a1 T A 6: 8,014,559 M949L probably benign Het
Coq8b T A 7: 27,250,591 M365K probably damaging Het
Cpa1 A G 6: 30,639,516 E18G possibly damaging Het
Csmd2 A G 4: 128,517,749 H2520R probably benign Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Dpm1 G A 2: 168,210,536 T260I probably damaging Het
Dtx3 A T 10: 127,191,307 probably null Het
Eepd1 T C 9: 25,589,460 V401A possibly damaging Het
Ehhadh A G 16: 21,763,202 S347P possibly damaging Het
Elp3 A G 14: 65,547,864 probably null Het
Enam C T 5: 88,493,108 Q210* probably null Het
Epha1 C T 6: 42,363,816 R607H probably benign Het
Erich6 A G 3: 58,636,830 I112T probably benign Het
F830045P16Rik A G 2: 129,460,550 V374A possibly damaging Het
Fam171a2 C A 11: 102,438,685 R416L possibly damaging Het
Fam35a A G 14: 34,268,625 V108A probably benign Het
Fbn1 T C 2: 125,372,399 N764S probably benign Het
Flad1 G A 3: 89,405,910 R342C probably damaging Het
Fzd3 A G 14: 65,239,820 V95A probably benign Het
Garem1 T C 18: 21,147,893 T469A probably benign Het
Gm13084 G A 4: 143,810,805 Q319* probably null Het
Gm17093 A G 14: 44,518,348 Y24C unknown Het
Gm4788 T A 1: 139,733,443 D556V probably damaging Het
Gm7534 A G 4: 134,193,099 V585A probably benign Het
Grap2 T C 15: 80,638,561 V96A possibly damaging Het
Greb1 A T 12: 16,684,360 probably null Het
Grid2ip A T 5: 143,388,775 K913* probably null Het
Gzmk T C 13: 113,173,021 D126G probably damaging Het
Hibch A G 1: 52,885,178 I171V possibly damaging Het
Hipk2 G T 6: 38,818,404 T310K possibly damaging Het
Hk3 T C 13: 55,006,418 Y815C probably damaging Het
Hps5 A T 7: 46,788,354 V99E probably damaging Het
Hspg2 A G 4: 137,541,666 H2203R possibly damaging Het
Il12rb2 A G 6: 67,309,137 V108A probably damaging Het
Il6st C T 13: 112,490,510 R279* probably null Het
Kdm2a A C 19: 4,325,026 S692R probably benign Het
Kif13a T C 13: 46,826,748 K176R probably damaging Het
Kif5b T C 18: 6,216,869 K485E probably damaging Het
Ktn1 C T 14: 47,725,956 R1111* probably null Het
Lrrc23 A T 6: 124,778,189 N128K probably benign Het
Mad1l1 G A 5: 140,300,262 Q293* probably null Het
Man1b1 A T 2: 25,345,475 I338F possibly damaging Het
March1 G T 8: 66,468,363 V225L probably damaging Het
Mrpl3 A G 9: 105,057,032 D118G probably damaging Het
Nomo1 A T 7: 46,083,715 Q1209L unknown Het
Nrcam A G 12: 44,574,019 E949G probably damaging Het
Olfm5 T G 7: 104,154,365 N297T probably damaging Het
Olfr573-ps1 T A 7: 102,942,246 L110F probably damaging Het
Pcdh7 A T 5: 57,720,804 N567I probably damaging Het
Pkn1 A G 8: 83,677,966 L495P probably damaging Het
Pkp1 T C 1: 135,882,588 S415G probably damaging Het
Pou2f1 T A 1: 165,916,923 Q53L probably null Het
Prkce A G 17: 86,630,083 K648R probably benign Het
Ptprh G A 7: 4,573,430 T277I possibly damaging Het
Rpl31 C T 1: 39,370,967 R83C probably benign Het
Rpusd3 G A 6: 113,416,876 Q194* probably null Het
Sgsm1 T A 5: 113,282,626 N298Y probably damaging Het
She G A 3: 89,851,639 G355D probably benign Het
Snx11 C T 11: 96,774,458 E9K possibly damaging Het
Soat1 C A 1: 156,432,937 A444S probably benign Het
Sox6 T C 7: 115,486,662 Y690C probably damaging Het
Spata13 T A 14: 60,733,179 F10I probably benign Het
St18 C A 1: 6,802,905 T288K probably benign Het
Tifa C T 3: 127,796,586 S2F probably damaging Het
Tmem232 A T 17: 65,430,888 S392R probably benign Het
Tmtc3 T C 10: 100,466,220 N289S probably damaging Het
Tpo A G 12: 30,092,634 F697S probably damaging Het
Trp53 A G 11: 69,587,630 T122A probably damaging Het
Trps1 A C 15: 50,827,316 I10S probably benign Het
Tubgcp5 C T 7: 55,794,185 probably benign Het
Unc13c T G 9: 73,932,072 Y499S possibly damaging Het
Unc45a C A 7: 80,333,035 D381Y probably damaging Het
Upf1 G C 8: 70,339,368 H402Q probably benign Het
Uroc1 A T 6: 90,349,192 I510F possibly damaging Het
Usp15 A G 10: 123,127,757 F589L probably damaging Het
Vmn2r76 T C 7: 86,225,525 Y748C probably damaging Het
Wwp1 T C 4: 19,662,143 N151D probably benign Het
Zbtb40 A T 4: 137,001,216 S439T probably benign Het
Zbtb6 A T 2: 37,428,716 L400* probably null Het
Zfp125 C T 12: 20,899,960 noncoding transcript Het
Zmynd8 A C 2: 165,840,034 Y183* probably null Het
Other mutations in Fip1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Fip1l1 APN 5 74587065 splice site probably benign
IGL02008:Fip1l1 APN 5 74545423 missense possibly damaging 0.80
IGL02069:Fip1l1 APN 5 74591873 missense probably damaging 1.00
IGL02406:Fip1l1 APN 5 74564544 missense probably benign 0.01
IGL02514:Fip1l1 APN 5 74571152 missense probably damaging 1.00
IGL03139:Fip1l1 APN 5 74571115 missense possibly damaging 0.84
R0031:Fip1l1 UTSW 5 74557109 missense probably damaging 1.00
R0325:Fip1l1 UTSW 5 74595842 missense probably damaging 1.00
R0600:Fip1l1 UTSW 5 74595842 missense probably damaging 1.00
R0834:Fip1l1 UTSW 5 74595060 unclassified probably benign
R1183:Fip1l1 UTSW 5 74595102 missense probably damaging 1.00
R1328:Fip1l1 UTSW 5 74546135 missense possibly damaging 0.94
R2434:Fip1l1 UTSW 5 74546824 missense possibly damaging 0.81
R4120:Fip1l1 UTSW 5 74588191 missense probably damaging 1.00
R4197:Fip1l1 UTSW 5 74535736 missense probably damaging 1.00
R4440:Fip1l1 UTSW 5 74536785 intron probably benign
R4825:Fip1l1 UTSW 5 74588205 splice site probably null
R5800:Fip1l1 UTSW 5 74546081 missense possibly damaging 0.77
R6159:Fip1l1 UTSW 5 74591947 missense probably damaging 1.00
R6556:Fip1l1 UTSW 5 74547177 critical splice donor site probably null
R6724:Fip1l1 UTSW 5 74591774 missense probably damaging 0.99
R6984:Fip1l1 UTSW 5 74542073 missense probably damaging 0.99
R7092:Fip1l1 UTSW 5 74536843 missense probably damaging 0.98
R7205:Fip1l1 UTSW 5 74588075 intron probably null
R7325:Fip1l1 UTSW 5 74536799 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACTGAATCCCATAACCTGTGC -3'
(R):5'- TGCTGCTTACAGTACTTGGAATC -3'

Sequencing Primer
(F):5'- ATCCCATAACCTGTGCTTTTAATGTG -3'
(R):5'- GCTTACAGTACTTGGAATCCTCAAG -3'
Posted On2016-03-01