Incidental Mutation 'R4838:Ptprh'
ID371528
Institutional Source Beutler Lab
Gene Symbol Ptprh
Ensembl Gene ENSMUSG00000035429
Gene Nameprotein tyrosine phosphatase, receptor type, H
SynonymsSAP-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4838 (G1)
Quality Score157
Status Not validated
Chromosome7
Chromosomal Location4548612-4604041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4573430 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 277 (T277I)
Ref Sequence ENSEMBL: ENSMUSP00000145543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049113] [ENSMUST00000166650] [ENSMUST00000206999]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049113
AA Change: T277I

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000042396
Gene: ENSMUSG00000035429
AA Change: T277I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FN3 67 145 2.42e-9 SMART
FN3 156 234 9.69e-9 SMART
FN3 245 323 1.57e-8 SMART
FN3 334 412 6.29e-8 SMART
FN3 427 505 7.75e-8 SMART
FN3 516 593 1.21e0 SMART
transmembrane domain 605 627 N/A INTRINSIC
PTPc 670 932 1.09e-132 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166650
AA Change: T277I

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125833
Gene: ENSMUSG00000035429
AA Change: T277I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FN3 67 145 2.42e-9 SMART
FN3 156 234 9.69e-9 SMART
FN3 245 323 1.57e-8 SMART
FN3 334 412 6.29e-8 SMART
FN3 427 505 7.75e-8 SMART
FN3 516 593 1.21e0 SMART
transmembrane domain 605 627 N/A INTRINSIC
PTPc 670 932 1.09e-132 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000206999
AA Change: T277I

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single intracytoplasmic catalytic domain, and thus represents a receptor-type PTP. The extracellular region contains eight fibronectin type III-like repeats and multiple N-glycosylation sites. The gene was shown to be expressed primarily in brain and liver, and at a lower level in heart and stomach. It was also found to be expressed in several cancer cell lines, but not in the corresponding normal tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a null alllele exhibit normal intestinal epithelial cell morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A T 9: 22,424,377 D97V probably damaging Het
Abca15 T C 7: 120,345,300 V386A probably benign Het
Adk G A 14: 21,369,086 A247T probably damaging Het
Ankrd27 T A 7: 35,591,806 L9Q possibly damaging Het
Atad2 A G 15: 58,103,283 L638P probably damaging Het
Atf7ip T A 6: 136,596,491 D1009E probably benign Het
Bend7 A T 2: 4,744,322 K83N probably damaging Het
Bicc1 C T 10: 70,945,316 D562N possibly damaging Het
Calcrl T A 2: 84,351,205 N200Y probably damaging Het
Ccdc125 C A 13: 100,677,945 A11E possibly damaging Het
Cd5l A G 3: 87,365,951 T76A probably benign Het
Cdhr5 A T 7: 141,273,731 I2N probably damaging Het
Cdk10 C T 8: 123,230,614 A230V probably damaging Het
Cep128 T C 12: 90,999,545 probably benign Het
Cep131 T C 11: 120,076,156 N186D probably damaging Het
Cog7 G T 7: 121,971,381 P168Q probably damaging Het
Col28a1 T A 6: 8,014,559 M949L probably benign Het
Coq8b T A 7: 27,250,591 M365K probably damaging Het
Cpa1 A G 6: 30,639,516 E18G possibly damaging Het
Csmd2 A G 4: 128,517,749 H2520R probably benign Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Dpm1 G A 2: 168,210,536 T260I probably damaging Het
Dtx3 A T 10: 127,191,307 probably null Het
Eepd1 T C 9: 25,589,460 V401A possibly damaging Het
Ehhadh A G 16: 21,763,202 S347P possibly damaging Het
Elp3 A G 14: 65,547,864 probably null Het
Enam C T 5: 88,493,108 Q210* probably null Het
Epha1 C T 6: 42,363,816 R607H probably benign Het
Erich6 A G 3: 58,636,830 I112T probably benign Het
F830045P16Rik A G 2: 129,460,550 V374A possibly damaging Het
Fam171a2 C A 11: 102,438,685 R416L possibly damaging Het
Fam35a A G 14: 34,268,625 V108A probably benign Het
Fbn1 T C 2: 125,372,399 N764S probably benign Het
Fip1l1 C T 5: 74,591,939 T469I probably damaging Het
Flad1 G A 3: 89,405,910 R342C probably damaging Het
Fzd3 A G 14: 65,239,820 V95A probably benign Het
Garem1 T C 18: 21,147,893 T469A probably benign Het
Gm13084 G A 4: 143,810,805 Q319* probably null Het
Gm17093 A G 14: 44,518,348 Y24C unknown Het
Gm4788 T A 1: 139,733,443 D556V probably damaging Het
Gm7534 A G 4: 134,193,099 V585A probably benign Het
Grap2 T C 15: 80,638,561 V96A possibly damaging Het
Greb1 A T 12: 16,684,360 probably null Het
Grid2ip A T 5: 143,388,775 K913* probably null Het
Gzmk T C 13: 113,173,021 D126G probably damaging Het
Hibch A G 1: 52,885,178 I171V possibly damaging Het
Hipk2 G T 6: 38,818,404 T310K possibly damaging Het
Hk3 T C 13: 55,006,418 Y815C probably damaging Het
Hps5 A T 7: 46,788,354 V99E probably damaging Het
Hspg2 A G 4: 137,541,666 H2203R possibly damaging Het
Il12rb2 A G 6: 67,309,137 V108A probably damaging Het
Il6st C T 13: 112,490,510 R279* probably null Het
Kdm2a A C 19: 4,325,026 S692R probably benign Het
Kif13a T C 13: 46,826,748 K176R probably damaging Het
Kif5b T C 18: 6,216,869 K485E probably damaging Het
Ktn1 C T 14: 47,725,956 R1111* probably null Het
Lrrc23 A T 6: 124,778,189 N128K probably benign Het
Mad1l1 G A 5: 140,300,262 Q293* probably null Het
Man1b1 A T 2: 25,345,475 I338F possibly damaging Het
March1 G T 8: 66,468,363 V225L probably damaging Het
Mrpl3 A G 9: 105,057,032 D118G probably damaging Het
Nomo1 A T 7: 46,083,715 Q1209L unknown Het
Nrcam A G 12: 44,574,019 E949G probably damaging Het
Olfm5 T G 7: 104,154,365 N297T probably damaging Het
Olfr573-ps1 T A 7: 102,942,246 L110F probably damaging Het
Pcdh7 A T 5: 57,720,804 N567I probably damaging Het
Pkn1 A G 8: 83,677,966 L495P probably damaging Het
Pkp1 T C 1: 135,882,588 S415G probably damaging Het
Pou2f1 T A 1: 165,916,923 Q53L probably null Het
Prkce A G 17: 86,630,083 K648R probably benign Het
Rpl31 C T 1: 39,370,967 R83C probably benign Het
Rpusd3 G A 6: 113,416,876 Q194* probably null Het
Sgsm1 T A 5: 113,282,626 N298Y probably damaging Het
She G A 3: 89,851,639 G355D probably benign Het
Snx11 C T 11: 96,774,458 E9K possibly damaging Het
Soat1 C A 1: 156,432,937 A444S probably benign Het
Sox6 T C 7: 115,486,662 Y690C probably damaging Het
Spata13 T A 14: 60,733,179 F10I probably benign Het
St18 C A 1: 6,802,905 T288K probably benign Het
Tifa C T 3: 127,796,586 S2F probably damaging Het
Tmem232 A T 17: 65,430,888 S392R probably benign Het
Tmtc3 T C 10: 100,466,220 N289S probably damaging Het
Tpo A G 12: 30,092,634 F697S probably damaging Het
Trp53 A G 11: 69,587,630 T122A probably damaging Het
Trps1 A C 15: 50,827,316 I10S probably benign Het
Tubgcp5 C T 7: 55,794,185 probably benign Het
Unc13c T G 9: 73,932,072 Y499S possibly damaging Het
Unc45a C A 7: 80,333,035 D381Y probably damaging Het
Upf1 G C 8: 70,339,368 H402Q probably benign Het
Uroc1 A T 6: 90,349,192 I510F possibly damaging Het
Usp15 A G 10: 123,127,757 F589L probably damaging Het
Vmn2r76 T C 7: 86,225,525 Y748C probably damaging Het
Wwp1 T C 4: 19,662,143 N151D probably benign Het
Zbtb40 A T 4: 137,001,216 S439T probably benign Het
Zbtb6 A T 2: 37,428,716 L400* probably null Het
Zfp125 C T 12: 20,899,960 noncoding transcript Het
Zmynd8 A C 2: 165,840,034 Y183* probably null Het
Other mutations in Ptprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01766:Ptprh APN 7 4580916 missense probably benign 0.23
IGL02420:Ptprh APN 7 4580930 missense probably damaging 1.00
IGL02619:Ptprh APN 7 4549499 missense probably damaging 1.00
IGL02729:Ptprh APN 7 4580874 missense probably damaging 0.99
R0018:Ptprh UTSW 7 4601846 critical splice donor site probably null
R0049:Ptprh UTSW 7 4573362 missense possibly damaging 0.80
R0449:Ptprh UTSW 7 4598006 missense probably damaging 1.00
R0477:Ptprh UTSW 7 4597998 missense possibly damaging 0.87
R0626:Ptprh UTSW 7 4564272 missense probably benign 0.00
R0741:Ptprh UTSW 7 4554173 critical splice donor site probably null
R1068:Ptprh UTSW 7 4549463 missense possibly damaging 0.89
R1226:Ptprh UTSW 7 4603092 nonsense probably null
R1487:Ptprh UTSW 7 4552738 missense probably damaging 1.00
R1495:Ptprh UTSW 7 4580889 missense probably benign 0.02
R1537:Ptprh UTSW 7 4549699 missense probably damaging 1.00
R1601:Ptprh UTSW 7 4552638 missense probably damaging 1.00
R1731:Ptprh UTSW 7 4601913 missense probably benign 0.00
R1920:Ptprh UTSW 7 4549395 missense probably benign 0.25
R2082:Ptprh UTSW 7 4550775 missense probably damaging 1.00
R2180:Ptprh UTSW 7 4601868 missense probably benign 0.26
R2214:Ptprh UTSW 7 4552922 missense possibly damaging 0.78
R2245:Ptprh UTSW 7 4573346 missense probably benign 0.09
R2271:Ptprh UTSW 7 4603133 start gained probably benign
R3693:Ptprh UTSW 7 4554235 missense probably damaging 0.99
R3713:Ptprh UTSW 7 4571970 missense probably damaging 1.00
R4081:Ptprh UTSW 7 4580988 missense probably damaging 0.99
R4205:Ptprh UTSW 7 4597992 missense probably damaging 1.00
R4689:Ptprh UTSW 7 4597997 missense possibly damaging 0.74
R4782:Ptprh UTSW 7 4569577 missense probably benign 0.08
R4974:Ptprh UTSW 7 4551007 splice site probably null
R5218:Ptprh UTSW 7 4597920 missense probably benign 0.05
R5430:Ptprh UTSW 7 4551047 missense probably damaging 1.00
R5533:Ptprh UTSW 7 4549505 missense probably damaging 1.00
R5544:Ptprh UTSW 7 4580910 nonsense probably null
R5547:Ptprh UTSW 7 4554222 nonsense probably null
R5869:Ptprh UTSW 7 4601940 missense probably benign 0.00
R5928:Ptprh UTSW 7 4573508 missense probably damaging 1.00
R6063:Ptprh UTSW 7 4573362 missense possibly damaging 0.80
R6112:Ptprh UTSW 7 4597923 missense probably benign 0.01
R6493:Ptprh UTSW 7 4580990 missense possibly damaging 0.65
R6733:Ptprh UTSW 7 4603044 splice site probably null
R6836:Ptprh UTSW 7 4551135 missense probably damaging 1.00
R6859:Ptprh UTSW 7 4549371 nonsense probably null
R6868:Ptprh UTSW 7 4601865 missense probably benign
R7015:Ptprh UTSW 7 4552627 critical splice donor site probably null
R7092:Ptprh UTSW 7 4580861 critical splice donor site probably null
R7147:Ptprh UTSW 7 4550782 missense probably damaging 1.00
R7177:Ptprh UTSW 7 4569481 missense possibly damaging 0.77
R7358:Ptprh UTSW 7 4551007 splice site probably null
R7436:Ptprh UTSW 7 4552743 missense probably damaging 1.00
R7512:Ptprh UTSW 7 4571781 missense not run
Predicted Primers PCR Primer
(F):5'- ACCTGTGGTGTTACTGAGAGTC -3'
(R):5'- TGTAATGACAACCAGCCACATG -3'

Sequencing Primer
(F):5'- AGAGTCTCATTGGTGCTATAGACTCC -3'
(R):5'- CAGGGAAACTGTGCTTCCATG -3'
Posted On2016-03-01