Incidental Mutation 'R4838:Kif13a'
ID371565
Institutional Source Beutler Lab
Gene Symbol Kif13a
Ensembl Gene ENSMUSG00000021375
Gene Namekinesin family member 13A
Synonyms4930505I07Rik, N-3 kinesin
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.542) question?
Stock #R4838 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location46749087-46929867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46826748 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 176 (K176R)
Ref Sequence ENSEMBL: ENSMUSP00000055304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056978] [ENSMUST00000225591]
Predicted Effect probably damaging
Transcript: ENSMUST00000056978
AA Change: K176R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000055304
Gene: ENSMUSG00000021375
AA Change: K176R

DomainStartEndE-ValueType
KISc 3 360 2.69e-175 SMART
low complexity region 368 381 N/A INTRINSIC
low complexity region 391 406 N/A INTRINSIC
FHA 469 519 7.16e-2 SMART
coiled coil region 605 639 N/A INTRINSIC
coiled coil region 664 704 N/A INTRINSIC
Pfam:KIF1B 748 792 1.7e-19 PFAM
low complexity region 840 854 N/A INTRINSIC
low complexity region 903 915 N/A INTRINSIC
Pfam:DUF3694 1003 1270 2.2e-39 PFAM
low complexity region 1401 1412 N/A INTRINSIC
low complexity region 1475 1492 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000225591
AA Change: K113R

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin family of microtubule-based motor proteins that function in the positioning of endosomes. This family member can direct mannose-6-phosphate receptor-containing vesicles from the trans-Golgi network to the plasma membrane, and it is necessary for the steady-state distribution of late endosomes/lysosomes. It is also required for the translocation of FYVE-CENT and TTC19 from the centrosome to the midbody during cytokinesis, and it plays a role in melanosome maturation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased anxiety. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A T 9: 22,424,377 D97V probably damaging Het
Abca15 T C 7: 120,345,300 V386A probably benign Het
Adk G A 14: 21,369,086 A247T probably damaging Het
Ankrd27 T A 7: 35,591,806 L9Q possibly damaging Het
Atad2 A G 15: 58,103,283 L638P probably damaging Het
Atf7ip T A 6: 136,596,491 D1009E probably benign Het
Bend7 A T 2: 4,744,322 K83N probably damaging Het
Bicc1 C T 10: 70,945,316 D562N possibly damaging Het
Calcrl T A 2: 84,351,205 N200Y probably damaging Het
Ccdc125 C A 13: 100,677,945 A11E possibly damaging Het
Cd5l A G 3: 87,365,951 T76A probably benign Het
Cdhr5 A T 7: 141,273,731 I2N probably damaging Het
Cdk10 C T 8: 123,230,614 A230V probably damaging Het
Cep128 T C 12: 90,999,545 probably benign Het
Cep131 T C 11: 120,076,156 N186D probably damaging Het
Cog7 G T 7: 121,971,381 P168Q probably damaging Het
Col28a1 T A 6: 8,014,559 M949L probably benign Het
Coq8b T A 7: 27,250,591 M365K probably damaging Het
Cpa1 A G 6: 30,639,516 E18G possibly damaging Het
Csmd2 A G 4: 128,517,749 H2520R probably benign Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Dpm1 G A 2: 168,210,536 T260I probably damaging Het
Dtx3 A T 10: 127,191,307 probably null Het
Eepd1 T C 9: 25,589,460 V401A possibly damaging Het
Ehhadh A G 16: 21,763,202 S347P possibly damaging Het
Elp3 A G 14: 65,547,864 probably null Het
Enam C T 5: 88,493,108 Q210* probably null Het
Epha1 C T 6: 42,363,816 R607H probably benign Het
Erich6 A G 3: 58,636,830 I112T probably benign Het
F830045P16Rik A G 2: 129,460,550 V374A possibly damaging Het
Fam171a2 C A 11: 102,438,685 R416L possibly damaging Het
Fam35a A G 14: 34,268,625 V108A probably benign Het
Fbn1 T C 2: 125,372,399 N764S probably benign Het
Fip1l1 C T 5: 74,591,939 T469I probably damaging Het
Flad1 G A 3: 89,405,910 R342C probably damaging Het
Fzd3 A G 14: 65,239,820 V95A probably benign Het
Garem1 T C 18: 21,147,893 T469A probably benign Het
Gm13084 G A 4: 143,810,805 Q319* probably null Het
Gm17093 A G 14: 44,518,348 Y24C unknown Het
Gm4788 T A 1: 139,733,443 D556V probably damaging Het
Gm7534 A G 4: 134,193,099 V585A probably benign Het
Grap2 T C 15: 80,638,561 V96A possibly damaging Het
Greb1 A T 12: 16,684,360 probably null Het
Grid2ip A T 5: 143,388,775 K913* probably null Het
Gzmk T C 13: 113,173,021 D126G probably damaging Het
Hibch A G 1: 52,885,178 I171V possibly damaging Het
Hipk2 G T 6: 38,818,404 T310K possibly damaging Het
Hk3 T C 13: 55,006,418 Y815C probably damaging Het
Hps5 A T 7: 46,788,354 V99E probably damaging Het
Hspg2 A G 4: 137,541,666 H2203R possibly damaging Het
Il12rb2 A G 6: 67,309,137 V108A probably damaging Het
Il6st C T 13: 112,490,510 R279* probably null Het
Kdm2a A C 19: 4,325,026 S692R probably benign Het
Kif5b T C 18: 6,216,869 K485E probably damaging Het
Ktn1 C T 14: 47,725,956 R1111* probably null Het
Lrrc23 A T 6: 124,778,189 N128K probably benign Het
Mad1l1 G A 5: 140,300,262 Q293* probably null Het
Man1b1 A T 2: 25,345,475 I338F possibly damaging Het
March1 G T 8: 66,468,363 V225L probably damaging Het
Mrpl3 A G 9: 105,057,032 D118G probably damaging Het
Nomo1 A T 7: 46,083,715 Q1209L unknown Het
Nrcam A G 12: 44,574,019 E949G probably damaging Het
Olfm5 T G 7: 104,154,365 N297T probably damaging Het
Olfr573-ps1 T A 7: 102,942,246 L110F probably damaging Het
Pcdh7 A T 5: 57,720,804 N567I probably damaging Het
Pkn1 A G 8: 83,677,966 L495P probably damaging Het
Pkp1 T C 1: 135,882,588 S415G probably damaging Het
Pou2f1 T A 1: 165,916,923 Q53L probably null Het
Prkce A G 17: 86,630,083 K648R probably benign Het
Ptprh G A 7: 4,573,430 T277I possibly damaging Het
Rpl31 C T 1: 39,370,967 R83C probably benign Het
Rpusd3 G A 6: 113,416,876 Q194* probably null Het
Sgsm1 T A 5: 113,282,626 N298Y probably damaging Het
She G A 3: 89,851,639 G355D probably benign Het
Snx11 C T 11: 96,774,458 E9K possibly damaging Het
Soat1 C A 1: 156,432,937 A444S probably benign Het
Sox6 T C 7: 115,486,662 Y690C probably damaging Het
Spata13 T A 14: 60,733,179 F10I probably benign Het
St18 C A 1: 6,802,905 T288K probably benign Het
Tifa C T 3: 127,796,586 S2F probably damaging Het
Tmem232 A T 17: 65,430,888 S392R probably benign Het
Tmtc3 T C 10: 100,466,220 N289S probably damaging Het
Tpo A G 12: 30,092,634 F697S probably damaging Het
Trp53 A G 11: 69,587,630 T122A probably damaging Het
Trps1 A C 15: 50,827,316 I10S probably benign Het
Tubgcp5 C T 7: 55,794,185 probably benign Het
Unc13c T G 9: 73,932,072 Y499S possibly damaging Het
Unc45a C A 7: 80,333,035 D381Y probably damaging Het
Upf1 G C 8: 70,339,368 H402Q probably benign Het
Uroc1 A T 6: 90,349,192 I510F possibly damaging Het
Usp15 A G 10: 123,127,757 F589L probably damaging Het
Vmn2r76 T C 7: 86,225,525 Y748C probably damaging Het
Wwp1 T C 4: 19,662,143 N151D probably benign Het
Zbtb40 A T 4: 137,001,216 S439T probably benign Het
Zbtb6 A T 2: 37,428,716 L400* probably null Het
Zfp125 C T 12: 20,899,960 noncoding transcript Het
Zmynd8 A C 2: 165,840,034 Y183* probably null Het
Other mutations in Kif13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Kif13a APN 13 46750634 splice site probably benign
IGL01433:Kif13a APN 13 46772908 missense probably damaging 1.00
IGL01528:Kif13a APN 13 46864837 splice site probably benign
IGL01536:Kif13a APN 13 46752289 missense probably damaging 0.96
IGL01620:Kif13a APN 13 46864820 missense probably benign
IGL02020:Kif13a APN 13 46794019 missense probably benign 0.05
IGL02142:Kif13a APN 13 46771535 missense probably benign 0.04
IGL02375:Kif13a APN 13 46825222 missense probably damaging 1.00
IGL02407:Kif13a APN 13 46785293 missense probably damaging 0.99
IGL02476:Kif13a APN 13 46785296 missense probably damaging 1.00
IGL03038:Kif13a APN 13 46772838 missense probably damaging 1.00
IGL03053:Kif13a APN 13 46752088 missense probably benign 0.01
IGL03366:Kif13a APN 13 46764623 missense probably benign 0.00
R0025:Kif13a UTSW 13 46786511 critical splice donor site probably null
R0106:Kif13a UTSW 13 46825347 splice site probably benign
R0106:Kif13a UTSW 13 46825347 splice site probably benign
R0135:Kif13a UTSW 13 46793943 missense probably damaging 0.99
R0137:Kif13a UTSW 13 46764603 missense probably benign 0.38
R0243:Kif13a UTSW 13 46791351 missense probably benign 0.24
R0346:Kif13a UTSW 13 46814219 missense possibly damaging 0.95
R0403:Kif13a UTSW 13 46791401 missense probably damaging 1.00
R0492:Kif13a UTSW 13 46812742 missense possibly damaging 0.93
R0607:Kif13a UTSW 13 46802711 missense probably damaging 0.96
R0631:Kif13a UTSW 13 46778888 unclassified probably benign
R0654:Kif13a UTSW 13 46812742 missense possibly damaging 0.93
R0697:Kif13a UTSW 13 46848337 missense probably benign 0.19
R0699:Kif13a UTSW 13 46799213 missense possibly damaging 0.92
R0715:Kif13a UTSW 13 46812823 missense probably damaging 0.98
R0834:Kif13a UTSW 13 46814236 missense probably damaging 0.96
R0903:Kif13a UTSW 13 46929259 missense possibly damaging 0.75
R1419:Kif13a UTSW 13 46825235 missense probably damaging 1.00
R1428:Kif13a UTSW 13 46791511 splice site probably benign
R1449:Kif13a UTSW 13 46812736 missense probably damaging 1.00
R1463:Kif13a UTSW 13 46929612 missense possibly damaging 0.75
R1541:Kif13a UTSW 13 46809213 missense probably benign
R1579:Kif13a UTSW 13 46752856 missense possibly damaging 0.93
R1582:Kif13a UTSW 13 46793922 missense probably benign 0.03
R1644:Kif13a UTSW 13 46793922 missense probably benign 0.31
R1752:Kif13a UTSW 13 46798409 missense probably damaging 1.00
R1755:Kif13a UTSW 13 46752613 missense possibly damaging 0.73
R1755:Kif13a UTSW 13 46773678 missense possibly damaging 0.50
R1858:Kif13a UTSW 13 46864838 splice site probably benign
R1891:Kif13a UTSW 13 46929219 missense possibly damaging 0.63
R1902:Kif13a UTSW 13 46788162 missense probably benign 0.00
R1928:Kif13a UTSW 13 46812745 missense probably damaging 1.00
R1960:Kif13a UTSW 13 46864838 splice site probably benign
R1961:Kif13a UTSW 13 46864838 splice site probably benign
R2016:Kif13a UTSW 13 46810799 missense probably benign 0.13
R2139:Kif13a UTSW 13 46752469 missense possibly damaging 0.92
R2174:Kif13a UTSW 13 46769176 missense probably damaging 0.99
R2407:Kif13a UTSW 13 46777097 missense probably damaging 1.00
R2504:Kif13a UTSW 13 46814200 missense probably damaging 1.00
R3122:Kif13a UTSW 13 46764596 splice site probably benign
R3499:Kif13a UTSW 13 46825339 missense probably damaging 1.00
R3905:Kif13a UTSW 13 46802690 missense probably damaging 1.00
R4474:Kif13a UTSW 13 46814155 splice site probably null
R4771:Kif13a UTSW 13 46825211 missense probably damaging 1.00
R4924:Kif13a UTSW 13 46929599 missense probably damaging 1.00
R4931:Kif13a UTSW 13 46809055 missense probably damaging 0.96
R4980:Kif13a UTSW 13 46752746 missense possibly damaging 0.76
R4992:Kif13a UTSW 13 46777163 missense probably damaging 0.96
R5047:Kif13a UTSW 13 46788085 missense probably benign 0.00
R5054:Kif13a UTSW 13 46802646 missense probably damaging 1.00
R5141:Kif13a UTSW 13 46752721 missense probably benign
R5329:Kif13a UTSW 13 46775401 critical splice donor site probably null
R5429:Kif13a UTSW 13 46772769 critical splice donor site probably null
R5499:Kif13a UTSW 13 46832736 missense probably damaging 1.00
R5509:Kif13a UTSW 13 46752115 missense probably benign 0.13
R5594:Kif13a UTSW 13 46752862 missense probably damaging 1.00
R5921:Kif13a UTSW 13 46825300 missense probably damaging 1.00
R5964:Kif13a UTSW 13 46771524 missense probably damaging 1.00
R6115:Kif13a UTSW 13 46801313 missense probably damaging 1.00
R6317:Kif13a UTSW 13 46826757 missense probably damaging 1.00
R6318:Kif13a UTSW 13 46815207 splice site probably null
R6393:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R6394:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R6395:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R6735:Kif13a UTSW 13 46752746 missense possibly damaging 0.76
R7037:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7038:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7039:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7237:Kif13a UTSW 13 46809156 critical splice donor site probably null
R7285:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7286:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7287:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7341:Kif13a UTSW 13 46826745 missense probably damaging 1.00
X0013:Kif13a UTSW 13 46929270 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- ACAAGGCAGCCTGAAGTGTG -3'
(R):5'- ATAAAGTGGCCATTAAAGCACCTTC -3'

Sequencing Primer
(F):5'- GTGTGACTGAAGGACACCATTCC -3'
(R):5'- GTGGCCATTAAAGCACCTTCTAATC -3'
Posted On2016-03-01