Incidental Mutation 'R4838:Fam35a'
ID371571
Institutional Source Beutler Lab
Gene Symbol Fam35a
Ensembl Gene ENSMUSG00000041471
Gene Namefamily with sequence similarity 35, member A
Synonyms3110001K24Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R4838 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location34237033-34310493 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34268625 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 108 (V108A)
Ref Sequence ENSEMBL: ENSMUSP00000153771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111917] [ENSMUST00000227006] [ENSMUST00000227375] [ENSMUST00000228337] [ENSMUST00000228626] [ENSMUST00000228704]
Predicted Effect probably benign
Transcript: ENSMUST00000111917
AA Change: V108A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000107548
Gene: ENSMUSG00000041471
AA Change: V108A

DomainStartEndE-ValueType
low complexity region 66 75 N/A INTRINSIC
low complexity region 163 177 N/A INTRINSIC
Pfam:FAM35_C 694 866 4.6e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227006
Predicted Effect probably benign
Transcript: ENSMUST00000227375
AA Change: V108A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228132
Predicted Effect probably benign
Transcript: ENSMUST00000228337
AA Change: V108A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000228626
AA Change: V108A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000228704
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A T 9: 22,424,377 D97V probably damaging Het
Abca15 T C 7: 120,345,300 V386A probably benign Het
Adk G A 14: 21,369,086 A247T probably damaging Het
Ankrd27 T A 7: 35,591,806 L9Q possibly damaging Het
Atad2 A G 15: 58,103,283 L638P probably damaging Het
Atf7ip T A 6: 136,596,491 D1009E probably benign Het
Bend7 A T 2: 4,744,322 K83N probably damaging Het
Bicc1 C T 10: 70,945,316 D562N possibly damaging Het
Calcrl T A 2: 84,351,205 N200Y probably damaging Het
Ccdc125 C A 13: 100,677,945 A11E possibly damaging Het
Cd5l A G 3: 87,365,951 T76A probably benign Het
Cdhr5 A T 7: 141,273,731 I2N probably damaging Het
Cdk10 C T 8: 123,230,614 A230V probably damaging Het
Cep128 T C 12: 90,999,545 probably benign Het
Cep131 T C 11: 120,076,156 N186D probably damaging Het
Cog7 G T 7: 121,971,381 P168Q probably damaging Het
Col28a1 T A 6: 8,014,559 M949L probably benign Het
Coq8b T A 7: 27,250,591 M365K probably damaging Het
Cpa1 A G 6: 30,639,516 E18G possibly damaging Het
Csmd2 A G 4: 128,517,749 H2520R probably benign Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Dpm1 G A 2: 168,210,536 T260I probably damaging Het
Dtx3 A T 10: 127,191,307 probably null Het
Eepd1 T C 9: 25,589,460 V401A possibly damaging Het
Ehhadh A G 16: 21,763,202 S347P possibly damaging Het
Elp3 A G 14: 65,547,864 probably null Het
Enam C T 5: 88,493,108 Q210* probably null Het
Epha1 C T 6: 42,363,816 R607H probably benign Het
Erich6 A G 3: 58,636,830 I112T probably benign Het
F830045P16Rik A G 2: 129,460,550 V374A possibly damaging Het
Fam171a2 C A 11: 102,438,685 R416L possibly damaging Het
Fbn1 T C 2: 125,372,399 N764S probably benign Het
Fip1l1 C T 5: 74,591,939 T469I probably damaging Het
Flad1 G A 3: 89,405,910 R342C probably damaging Het
Fzd3 A G 14: 65,239,820 V95A probably benign Het
Garem1 T C 18: 21,147,893 T469A probably benign Het
Gm13084 G A 4: 143,810,805 Q319* probably null Het
Gm17093 A G 14: 44,518,348 Y24C unknown Het
Gm4788 T A 1: 139,733,443 D556V probably damaging Het
Gm7534 A G 4: 134,193,099 V585A probably benign Het
Grap2 T C 15: 80,638,561 V96A possibly damaging Het
Greb1 A T 12: 16,684,360 probably null Het
Grid2ip A T 5: 143,388,775 K913* probably null Het
Gzmk T C 13: 113,173,021 D126G probably damaging Het
Hibch A G 1: 52,885,178 I171V possibly damaging Het
Hipk2 G T 6: 38,818,404 T310K possibly damaging Het
Hk3 T C 13: 55,006,418 Y815C probably damaging Het
Hps5 A T 7: 46,788,354 V99E probably damaging Het
Hspg2 A G 4: 137,541,666 H2203R possibly damaging Het
Il12rb2 A G 6: 67,309,137 V108A probably damaging Het
Il6st C T 13: 112,490,510 R279* probably null Het
Kdm2a A C 19: 4,325,026 S692R probably benign Het
Kif13a T C 13: 46,826,748 K176R probably damaging Het
Kif5b T C 18: 6,216,869 K485E probably damaging Het
Ktn1 C T 14: 47,725,956 R1111* probably null Het
Lrrc23 A T 6: 124,778,189 N128K probably benign Het
Mad1l1 G A 5: 140,300,262 Q293* probably null Het
Man1b1 A T 2: 25,345,475 I338F possibly damaging Het
March1 G T 8: 66,468,363 V225L probably damaging Het
Mrpl3 A G 9: 105,057,032 D118G probably damaging Het
Nomo1 A T 7: 46,083,715 Q1209L unknown Het
Nrcam A G 12: 44,574,019 E949G probably damaging Het
Olfm5 T G 7: 104,154,365 N297T probably damaging Het
Olfr573-ps1 T A 7: 102,942,246 L110F probably damaging Het
Pcdh7 A T 5: 57,720,804 N567I probably damaging Het
Pkn1 A G 8: 83,677,966 L495P probably damaging Het
Pkp1 T C 1: 135,882,588 S415G probably damaging Het
Pou2f1 T A 1: 165,916,923 Q53L probably null Het
Prkce A G 17: 86,630,083 K648R probably benign Het
Ptprh G A 7: 4,573,430 T277I possibly damaging Het
Rpl31 C T 1: 39,370,967 R83C probably benign Het
Rpusd3 G A 6: 113,416,876 Q194* probably null Het
Sgsm1 T A 5: 113,282,626 N298Y probably damaging Het
She G A 3: 89,851,639 G355D probably benign Het
Snx11 C T 11: 96,774,458 E9K possibly damaging Het
Soat1 C A 1: 156,432,937 A444S probably benign Het
Sox6 T C 7: 115,486,662 Y690C probably damaging Het
Spata13 T A 14: 60,733,179 F10I probably benign Het
St18 C A 1: 6,802,905 T288K probably benign Het
Tifa C T 3: 127,796,586 S2F probably damaging Het
Tmem232 A T 17: 65,430,888 S392R probably benign Het
Tmtc3 T C 10: 100,466,220 N289S probably damaging Het
Tpo A G 12: 30,092,634 F697S probably damaging Het
Trp53 A G 11: 69,587,630 T122A probably damaging Het
Trps1 A C 15: 50,827,316 I10S probably benign Het
Tubgcp5 C T 7: 55,794,185 probably benign Het
Unc13c T G 9: 73,932,072 Y499S possibly damaging Het
Unc45a C A 7: 80,333,035 D381Y probably damaging Het
Upf1 G C 8: 70,339,368 H402Q probably benign Het
Uroc1 A T 6: 90,349,192 I510F possibly damaging Het
Usp15 A G 10: 123,127,757 F589L probably damaging Het
Vmn2r76 T C 7: 86,225,525 Y748C probably damaging Het
Wwp1 T C 4: 19,662,143 N151D probably benign Het
Zbtb40 A T 4: 137,001,216 S439T probably benign Het
Zbtb6 A T 2: 37,428,716 L400* probably null Het
Zfp125 C T 12: 20,899,960 noncoding transcript Het
Zmynd8 A C 2: 165,840,034 Y183* probably null Het
Other mutations in Fam35a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Fam35a APN 14 34268625 missense probably benign 0.02
IGL00962:Fam35a APN 14 34249251 missense probably damaging 1.00
IGL01288:Fam35a APN 14 34259643 missense probably benign 0.00
IGL01302:Fam35a APN 14 34259727 missense probably benign 0.03
IGL01312:Fam35a APN 14 34268193 missense possibly damaging 0.56
IGL01444:Fam35a APN 14 34237557 missense probably damaging 1.00
IGL01633:Fam35a APN 14 34249179 missense probably damaging 1.00
IGL02251:Fam35a APN 14 34268278 missense probably benign 0.10
IGL02927:Fam35a APN 14 34267701 missense probably damaging 1.00
IGL03183:Fam35a APN 14 34245186 missense probably benign 0.02
IGL03226:Fam35a APN 14 34268371 missense probably benign 0.08
R0111:Fam35a UTSW 14 34267729 missense probably damaging 0.98
R1170:Fam35a UTSW 14 34268491 missense possibly damaging 0.92
R1348:Fam35a UTSW 14 34268923 missense probably damaging 1.00
R1467:Fam35a UTSW 14 34268662 missense possibly damaging 0.92
R1467:Fam35a UTSW 14 34268662 missense possibly damaging 0.92
R1538:Fam35a UTSW 14 34268876 missense probably damaging 1.00
R1602:Fam35a UTSW 14 34267650 missense probably damaging 1.00
R1650:Fam35a UTSW 14 34259617 intron probably benign
R1777:Fam35a UTSW 14 34268173 missense probably benign 0.07
R1843:Fam35a UTSW 14 34267803 missense probably benign 0.01
R2425:Fam35a UTSW 14 34268689 missense probably damaging 0.96
R3837:Fam35a UTSW 14 34249185 missense probably damaging 0.99
R3838:Fam35a UTSW 14 34245368 missense probably benign 0.01
R3904:Fam35a UTSW 14 34259709 missense probably damaging 1.00
R3964:Fam35a UTSW 14 34259687 missense probably damaging 1.00
R4322:Fam35a UTSW 14 34259675 missense probably damaging 0.99
R4708:Fam35a UTSW 14 34267833 missense probably benign 0.17
R4771:Fam35a UTSW 14 34268706 missense probably damaging 1.00
R5448:Fam35a UTSW 14 34268370 missense probably benign 0.32
R5874:Fam35a UTSW 14 34245258 missense probably benign 0.08
R6332:Fam35a UTSW 14 34268172 missense probably benign 0.07
R6333:Fam35a UTSW 14 34267608 missense probably damaging 1.00
R6476:Fam35a UTSW 14 34268014 missense probably benign 0.27
R6576:Fam35a UTSW 14 34268242 missense probably damaging 1.00
R7172:Fam35a UTSW 14 34237568 missense probably damaging 1.00
X0009:Fam35a UTSW 14 34245186 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAGATCCAGTTTCGCTGCAC -3'
(R):5'- AAACAGCATTCCTTGTATCTGAAGG -3'

Sequencing Primer
(F):5'- AGTTTCGCTGCACACTTAAGG -3'
(R):5'- CCTTGTATCTGAAGGCTGGAGATCAG -3'
Posted On2016-03-01