Incidental Mutation 'R4839:Vps13d'
ID371612
Institutional Source Beutler Lab
Gene Symbol Vps13d
Ensembl Gene ENSMUSG00000020220
Gene Namevacuolar protein sorting 13D
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4839 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location144972622-145195005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 145085430 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 3305 (T3305A)
Ref Sequence ENSEMBL: ENSMUSP00000020441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020441] [ENSMUST00000036579] [ENSMUST00000130704]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020441
AA Change: T3305A

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020441
Gene: ENSMUSG00000020220
AA Change: T3305A

DomainStartEndE-ValueType
Pfam:Chorein_N 2 118 1.8e-37 PFAM
low complexity region 407 423 N/A INTRINSIC
low complexity region 534 555 N/A INTRINSIC
coiled coil region 665 685 N/A INTRINSIC
low complexity region 765 781 N/A INTRINSIC
low complexity region 1316 1329 N/A INTRINSIC
low complexity region 1590 1603 N/A INTRINSIC
Blast:IL1 1605 1726 2e-6 BLAST
low complexity region 1868 1883 N/A INTRINSIC
low complexity region 2128 2141 N/A INTRINSIC
UBA 2632 2669 3.73e-5 SMART
low complexity region 2674 2684 N/A INTRINSIC
low complexity region 2707 2718 N/A INTRINSIC
low complexity region 2866 2884 N/A INTRINSIC
low complexity region 2973 2983 N/A INTRINSIC
Pfam:DUF1162 3246 3530 1.1e-110 PFAM
low complexity region 3797 3810 N/A INTRINSIC
low complexity region 3913 3921 N/A INTRINSIC
low complexity region 4119 4132 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000036579
AA Change: T3336A
SMART Domains Protein: ENSMUSP00000043240
Gene: ENSMUSG00000020220
AA Change: T3336A

DomainStartEndE-ValueType
Pfam:Chorein_N 2 116 3.5e-35 PFAM
Pfam:VPS13 131 353 9.6e-57 PFAM
low complexity region 407 423 N/A INTRINSIC
low complexity region 534 555 N/A INTRINSIC
Pfam:VPS13_mid_rpt 608 896 4.3e-35 PFAM
low complexity region 1316 1329 N/A INTRINSIC
low complexity region 1590 1603 N/A INTRINSIC
Blast:IL1 1605 1726 2e-6 BLAST
low complexity region 1868 1883 N/A INTRINSIC
low complexity region 2128 2141 N/A INTRINSIC
UBA 2632 2669 3.73e-5 SMART
low complexity region 2674 2684 N/A INTRINSIC
low complexity region 2707 2718 N/A INTRINSIC
low complexity region 2891 2909 N/A INTRINSIC
low complexity region 2998 3008 N/A INTRINSIC
Pfam:SHR-BD 3271 3555 4.2e-86 PFAM
low complexity region 3822 3835 N/A INTRINSIC
low complexity region 3938 3946 N/A INTRINSIC
Pfam:VPS13_C 3978 4126 4.8e-24 PFAM
low complexity region 4144 4157 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130704
AA Change: T221A

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000118699
Gene: ENSMUSG00000020220
AA Change: T221A

DomainStartEndE-ValueType
Pfam:DUF1162 162 446 1.4e-111 PFAM
low complexity region 713 726 N/A INTRINSIC
low complexity region 829 837 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000185113
AA Change: T2156A
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the vacuolar-protein-sorting-13 gene family. In yeast, vacuolar-protein-sorting-13 proteins are involved in trafficking of membrane proteins between the trans-Golgi network and the prevacuolar compartment. While several transcript variants may exist for this gene, the full-length natures of only two have been described to date. These two represent the major variants of this gene and encode distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T A 17: 9,008,013 S467T probably benign Het
2310030G06Rik A T 9: 50,740,723 Y68* probably null Het
4931408C20Rik T C 1: 26,685,359 T247A probably benign Het
9130019O22Rik T C 7: 127,385,007 S308G probably benign Het
Abat T G 16: 8,583,648 probably benign Het
Abca2 C T 2: 25,440,909 S1203F probably damaging Het
Adam22 G A 5: 8,136,813 P436L probably damaging Het
Ak3 A C 19: 29,047,732 L33R probably damaging Het
Arhgap11a A T 2: 113,842,029 I198K probably damaging Het
Arl14epl A T 18: 46,932,477 K103M possibly damaging Het
Atg16l1 T A 1: 87,766,174 N65K probably damaging Het
Btnl2 G A 17: 34,365,286 W394* probably null Het
Cacna1e C A 1: 154,421,058 R1687L probably damaging Het
Cacna1g G T 11: 94,459,607 R471S probably benign Het
Cdh13 A T 8: 118,851,848 R205* probably null Het
Cdkl3 A T 11: 52,005,034 Y36F probably damaging Het
Cep290 T A 10: 100,508,786 N488K probably damaging Het
Cep350 A T 1: 155,928,494 C948S probably benign Het
Cep70 A G 9: 99,296,085 K446R probably benign Het
Cfap70 T C 14: 20,425,529 T375A probably damaging Het
Cfhr1 A G 1: 139,560,133 L9S probably damaging Het
Chrm4 T A 2: 91,927,607 M120K probably damaging Het
Col1a1 A G 11: 94,950,095 probably null Het
Col3a1 T C 1: 45,323,803 probably null Het
Csrnp3 A T 2: 66,022,031 R256* probably null Het
Dbf4 T A 5: 8,408,263 K190* probably null Het
Dnah10 A T 5: 124,773,132 I1573F probably damaging Het
Dock8 A G 19: 25,169,494 I1446V probably benign Het
Dst G T 1: 34,190,862 R2187M probably damaging Het
Ece2 C T 16: 20,631,168 R257C probably damaging Het
Espn A G 4: 152,138,504 Y306H probably damaging Het
Fam208b G A 13: 3,584,807 P667S probably damaging Het
Fkbpl G A 17: 34,645,865 M202I probably benign Het
Fn1 A G 1: 71,642,083 L362P probably damaging Het
Ganc A C 2: 120,459,823 R880S probably benign Het
Gucy1b2 A T 14: 62,448,246 L90Q probably damaging Het
Hcn1 T A 13: 117,925,710 I504N unknown Het
Hdac2 C A 10: 36,997,466 T352K probably benign Het
Hip1 T C 5: 135,426,318 probably null Het
Hspa13 G A 16: 75,765,281 S10L probably damaging Het
Ipo5 T C 14: 120,920,038 I96T probably benign Het
Isl1 T C 13: 116,301,684 Y264C probably damaging Het
Izumo1 T C 7: 45,626,233 I322T probably benign Het
Kars A C 8: 112,002,526 V183G possibly damaging Het
Lrrc15 C A 16: 30,274,268 M84I probably benign Het
Magi1 A T 6: 93,694,196 V796E probably damaging Het
Matn4 G T 2: 164,400,976 D67E probably benign Het
Mertk A G 2: 128,782,576 M636V probably damaging Het
Mettl27 C A 5: 134,934,412 P126T probably damaging Het
Mfrp T A 9: 44,102,135 H52Q possibly damaging Het
Mrgprb8 T G 7: 48,388,908 I109R probably benign Het
Mroh2a G A 1: 88,237,944 G512S probably damaging Het
Ncoa7 T A 10: 30,722,659 R89S possibly damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nin G T 12: 70,090,551 H84N possibly damaging Het
Nwd2 A T 5: 63,805,550 I826F possibly damaging Het
Olfr195 A G 16: 59,149,030 Y60C probably damaging Het
Olfr299 T C 7: 86,465,909 F166S probably damaging Het
Olfr339 G A 2: 36,422,000 V201I probably benign Het
Olfr498 T C 7: 108,465,731 S136P probably benign Het
Olfr69 T C 7: 103,767,754 I214M possibly damaging Het
Olfr724 C T 14: 49,960,189 M294I probably benign Het
Olfr959 A G 9: 39,573,145 M38T probably benign Het
Otof C T 5: 30,419,404 R168H probably damaging Het
Pcdha6 T C 18: 36,968,432 V226A possibly damaging Het
Pggt1b T C 18: 46,258,099 I200V possibly damaging Het
Ppat G A 5: 76,950,964 Q41* probably null Het
Ppfibp2 A T 7: 107,742,985 H27L probably damaging Het
Rbm27 T A 18: 42,327,445 I775N probably damaging Het
Rnf40 C T 7: 127,592,640 R349* probably null Het
Rtp3 A T 9: 110,989,476 W46R probably damaging Het
Sass6 C T 3: 116,610,300 R196W probably damaging Het
Sel1l A T 12: 91,833,158 D131E probably benign Het
Slain2 T C 5: 72,948,723 S234P probably damaging Het
Slc47a1 C T 11: 61,373,350 probably null Het
Sp140 CAGAAGAAG CAGAAG 1: 85,610,808 probably benign Het
Spef2 A T 15: 9,713,178 Y369* probably null Het
Spred2 T A 11: 19,998,233 M76K possibly damaging Het
Svs2 T A 2: 164,236,886 D367V probably benign Het
Tefm A T 11: 80,137,121 D270E probably benign Het
Tfcp2l1 C A 1: 118,669,464 P425H probably benign Het
Thbd A T 2: 148,406,671 C426S probably damaging Het
Timm10b T A 7: 105,684,012 D968E probably damaging Het
Tle2 C T 10: 81,577,684 T119I probably damaging Het
Tnik T A 3: 28,596,075 Y446N possibly damaging Het
Tpr T A 1: 150,449,197 L2400* probably null Het
Trrap T C 5: 144,845,592 F3328S probably damaging Het
Vldlr G A 19: 27,238,065 C154Y probably damaging Het
Vmn1r79 T G 7: 12,176,434 M81R probably benign Het
Wdr62 T A 7: 30,241,465 I843F probably benign Het
Wdr62 T C 7: 30,270,686 E232G probably damaging Het
Zfp873 T A 10: 82,060,519 H361Q probably damaging Het
Zfp949 A C 9: 88,569,994 H539P probably damaging Het
Other mutations in Vps13d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Vps13d APN 4 145168540 missense probably damaging 0.98
IGL00484:Vps13d APN 4 145126575 missense probably benign 0.04
IGL00591:Vps13d APN 4 145190559 missense possibly damaging 0.95
IGL00816:Vps13d APN 4 145155994 missense probably benign 0.00
IGL00835:Vps13d APN 4 145160652 missense probably damaging 0.97
IGL00847:Vps13d APN 4 145085408 missense probably benign 0.26
IGL01084:Vps13d APN 4 145154955 missense probably benign 0.00
IGL01116:Vps13d APN 4 144972750 unclassified probably benign
IGL01150:Vps13d APN 4 145149275 missense probably benign
IGL01329:Vps13d APN 4 145156206 missense possibly damaging 0.69
IGL01338:Vps13d APN 4 145088322 missense probably damaging 1.00
IGL01583:Vps13d APN 4 145045088 missense probably damaging 1.00
IGL01598:Vps13d APN 4 145016901 missense probably benign 0.21
IGL01620:Vps13d APN 4 145094867 missense possibly damaging 0.70
IGL01636:Vps13d APN 4 145075048 missense probably damaging 1.00
IGL01723:Vps13d APN 4 145173145 missense possibly damaging 0.84
IGL01895:Vps13d APN 4 145156266 missense possibly damaging 0.57
IGL01981:Vps13d APN 4 145086747 missense probably damaging 0.99
IGL02192:Vps13d APN 4 145148858 missense probably benign 0.02
IGL02197:Vps13d APN 4 145128309 missense probably benign 0.01
IGL02209:Vps13d APN 4 145156101 missense probably damaging 0.97
IGL02219:Vps13d APN 4 145168146 missense probably benign 0.00
IGL02377:Vps13d APN 4 145156364 missense probably damaging 1.00
IGL02404:Vps13d APN 4 145148735 missense probably damaging 1.00
IGL02552:Vps13d APN 4 145173137 missense possibly damaging 0.46
IGL02651:Vps13d APN 4 145164559 missense probably benign 0.02
IGL02708:Vps13d APN 4 145128280 missense probably benign 0.12
IGL02811:Vps13d APN 4 145131765 missense possibly damaging 0.55
IGL02821:Vps13d APN 4 145148762 missense probably damaging 0.98
IGL02838:Vps13d APN 4 145075025 missense probably benign 0.31
IGL02968:Vps13d APN 4 145122498 missense probably benign 0.32
IGL03176:Vps13d APN 4 145074963 missense probably benign 0.16
IGL03352:Vps13d APN 4 145167502 missense possibly damaging 0.49
IGL03374:Vps13d APN 4 145108575 missense possibly damaging 0.70
IGL03375:Vps13d APN 4 145091947 missense probably damaging 1.00
IGL03383:Vps13d APN 4 145168319 critical splice acceptor site probably null
IGL03411:Vps13d APN 4 145149324 missense probably damaging 1.00
PIT4283001:Vps13d UTSW 4 145108588 missense
PIT4434001:Vps13d UTSW 4 145155247 missense
R0069:Vps13d UTSW 4 145062563 missense probably benign 0.09
R0069:Vps13d UTSW 4 145062563 missense probably benign 0.09
R0076:Vps13d UTSW 4 145164694 splice site probably benign
R0211:Vps13d UTSW 4 145114778 missense probably benign 0.08
R0219:Vps13d UTSW 4 145105909 missense probably benign 0.01
R0284:Vps13d UTSW 4 145144802 missense probably benign 0.01
R0345:Vps13d UTSW 4 145117625 missense possibly damaging 0.81
R0400:Vps13d UTSW 4 145065827 missense probably benign 0.00
R0417:Vps13d UTSW 4 144976560 missense probably benign 0.19
R0538:Vps13d UTSW 4 145045095 missense probably damaging 1.00
R0560:Vps13d UTSW 4 145054190 missense probably damaging 1.00
R0627:Vps13d UTSW 4 145087184 missense probably damaging 1.00
R0707:Vps13d UTSW 4 145155932 missense probably damaging 1.00
R0782:Vps13d UTSW 4 145126625 splice site probably benign
R0925:Vps13d UTSW 4 145156551 missense probably damaging 1.00
R0993:Vps13d UTSW 4 145117692 nonsense probably null
R1135:Vps13d UTSW 4 145155589 missense probably benign 0.01
R1165:Vps13d UTSW 4 145126471 missense probably benign
R1263:Vps13d UTSW 4 145170348 missense probably benign 0.01
R1397:Vps13d UTSW 4 145141334 missense probably damaging 1.00
R1398:Vps13d UTSW 4 145099983 missense probably null
R1521:Vps13d UTSW 4 145105861 missense probably benign 0.00
R1522:Vps13d UTSW 4 145098172 splice site probably null
R1725:Vps13d UTSW 4 145143260 missense possibly damaging 0.90
R1759:Vps13d UTSW 4 145155857 missense probably benign
R1826:Vps13d UTSW 4 145155003 missense probably damaging 0.96
R1900:Vps13d UTSW 4 145126606 missense probably benign 0.23
R1943:Vps13d UTSW 4 145155857 missense probably benign
R1955:Vps13d UTSW 4 145156143 missense probably damaging 1.00
R2008:Vps13d UTSW 4 145155243 missense probably benign 0.00
R2013:Vps13d UTSW 4 145108508 missense probably damaging 0.99
R2014:Vps13d UTSW 4 145108508 missense probably damaging 0.99
R2038:Vps13d UTSW 4 145181115 critical splice donor site probably null
R2108:Vps13d UTSW 4 145075047 missense probably damaging 0.99
R2130:Vps13d UTSW 4 145156101 missense probably benign 0.17
R2134:Vps13d UTSW 4 145148339 missense probably benign 0.00
R2168:Vps13d UTSW 4 145087323 splice site probably benign
R2220:Vps13d UTSW 4 145178320 missense probably damaging 1.00
R2240:Vps13d UTSW 4 145110895 missense possibly damaging 0.70
R2332:Vps13d UTSW 4 145148686 missense probably benign
R2357:Vps13d UTSW 4 145074977 frame shift probably null
R2365:Vps13d UTSW 4 145087324 splice site probably benign
R2571:Vps13d UTSW 4 145149136 missense probably benign 0.20
R3149:Vps13d UTSW 4 145126577 missense possibly damaging 0.70
R3150:Vps13d UTSW 4 145086790 missense probably damaging 0.98
R3547:Vps13d UTSW 4 145074975 missense probably damaging 0.99
R3716:Vps13d UTSW 4 145075726 missense probably damaging 1.00
R3718:Vps13d UTSW 4 145075726 missense probably damaging 1.00
R3725:Vps13d UTSW 4 145115648 splice site probably benign
R3794:Vps13d UTSW 4 145085437 splice site probably benign
R3875:Vps13d UTSW 4 145190544 missense probably damaging 1.00
R3948:Vps13d UTSW 4 145141340 missense probably damaging 1.00
R3953:Vps13d UTSW 4 145148880 missense probably damaging 1.00
R4021:Vps13d UTSW 4 145075061 missense possibly damaging 0.90
R4323:Vps13d UTSW 4 145152778 missense probably benign 0.28
R4346:Vps13d UTSW 4 145072529 intron probably benign
R4509:Vps13d UTSW 4 145062602 missense probably damaging 1.00
R4613:Vps13d UTSW 4 145131655 missense possibly damaging 0.95
R4657:Vps13d UTSW 4 145074842 missense probably damaging 1.00
R4680:Vps13d UTSW 4 145108510 missense possibly damaging 0.94
R4688:Vps13d UTSW 4 145178212 missense probably benign
R4797:Vps13d UTSW 4 145054155 missense probably damaging 1.00
R4798:Vps13d UTSW 4 145178056 missense probably damaging 0.98
R4817:Vps13d UTSW 4 145069165 missense probably damaging 1.00
R4860:Vps13d UTSW 4 145087161 missense probably benign
R4860:Vps13d UTSW 4 145087161 missense probably benign
R4869:Vps13d UTSW 4 145128042 missense probably damaging 1.00
R4904:Vps13d UTSW 4 145155445 missense probably damaging 1.00
R4912:Vps13d UTSW 4 145155857 missense probably benign
R4916:Vps13d UTSW 4 144983393 missense probably damaging 1.00
R4976:Vps13d UTSW 4 145105898 missense possibly damaging 0.82
R5029:Vps13d UTSW 4 145156282 missense probably benign 0.02
R5049:Vps13d UTSW 4 145086766 missense probably damaging 1.00
R5077:Vps13d UTSW 4 145088241 missense probably damaging 0.98
R5119:Vps13d UTSW 4 145105898 missense possibly damaging 0.82
R5227:Vps13d UTSW 4 145181207 splice site probably null
R5291:Vps13d UTSW 4 145062569 missense probably damaging 0.99
R5344:Vps13d UTSW 4 145178334 missense probably damaging 0.98
R5348:Vps13d UTSW 4 145065889 missense probably damaging 0.99
R5478:Vps13d UTSW 4 145167550 missense probably damaging 0.99
R5632:Vps13d UTSW 4 145074882 missense probably damaging 0.99
R5642:Vps13d UTSW 4 145170302 missense possibly damaging 0.66
R5712:Vps13d UTSW 4 145087173 missense probably benign 0.07
R5747:Vps13d UTSW 4 145168283 missense probably benign 0.00
R5752:Vps13d UTSW 4 145148970 missense probably benign 0.06
R5804:Vps13d UTSW 4 145100070 missense probably benign 0.03
R5917:Vps13d UTSW 4 145100010 missense probably damaging 0.96
R5932:Vps13d UTSW 4 145045041 missense possibly damaging 0.71
R5940:Vps13d UTSW 4 145074975 missense probably benign 0.09
R5978:Vps13d UTSW 4 145122611 missense probably benign
R6031:Vps13d UTSW 4 145168509 missense probably benign 0.01
R6031:Vps13d UTSW 4 145168509 missense probably benign 0.01
R6143:Vps13d UTSW 4 145148565 missense possibly damaging 0.95
R6174:Vps13d UTSW 4 144975193 nonsense probably null
R6191:Vps13d UTSW 4 145149348 missense probably damaging 1.00
R6198:Vps13d UTSW 4 145148990 missense probably benign 0.28
R6374:Vps13d UTSW 4 145122681 missense probably damaging 1.00
R6379:Vps13d UTSW 4 145088258 missense probably benign
R6388:Vps13d UTSW 4 145155574 missense probably benign 0.06
R6418:Vps13d UTSW 4 145092280 missense probably damaging 0.98
R6466:Vps13d UTSW 4 145057495 missense possibly damaging 0.47
R6602:Vps13d UTSW 4 145103664 intron probably benign
R6604:Vps13d UTSW 4 145181124 missense probably damaging 1.00
R7051:Vps13d UTSW 4 145163344 missense probably benign 0.00
R7052:Vps13d UTSW 4 145163344 missense probably benign 0.00
R7103:Vps13d UTSW 4 145115492 missense
X0021:Vps13d UTSW 4 145155025 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGGCCAACATGCATAGCTG -3'
(R):5'- TGCTATGCTGTGGCTACTTC -3'

Sequencing Primer
(F):5'- GCATAGCTGATTCACTTATGGAGGAC -3'
(R):5'- CTACTTCTGGAGTTAATTGTCTTGC -3'
Posted On2016-03-01