Incidental Mutation 'R4839:Otof'
ID371616
Institutional Source Beutler Lab
Gene Symbol Otof
Ensembl Gene ENSMUSG00000062372
Gene Nameotoferlin
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R4839 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location30367062-30461932 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30419404 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 168 (R168H)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074171] [ENSMUST00000114747]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074171
AA Change: R168H

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073803
Gene: ENSMUSG00000062372
AA Change: R168H

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 254 352 3.76e-11 SMART
FerI 338 409 7.91e-38 SMART
C2 417 528 1.75e-11 SMART
low complexity region 607 618 N/A INTRINSIC
FerB 841 917 5.13e-46 SMART
C2 960 1067 1.77e-7 SMART
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1265 1276 N/A INTRINSIC
low complexity region 1293 1323 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
low complexity region 1436 1447 N/A INTRINSIC
C2 1493 1592 6.54e-11 SMART
C2 1733 1863 4.02e0 SMART
Pfam:Ferlin_C 1895 1994 7.2e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114747
AA Change: R168H

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110395
Gene: ENSMUSG00000062372
AA Change: R168H

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 269 367 3.76e-11 SMART
FerI 353 424 7.91e-38 SMART
C2 432 543 1.75e-11 SMART
low complexity region 622 633 N/A INTRINSIC
FerB 856 932 5.13e-46 SMART
C2 975 1082 1.77e-7 SMART
Pfam:C2 1153 1236 1.8e-1 PFAM
low complexity region 1260 1271 N/A INTRINSIC
low complexity region 1288 1318 N/A INTRINSIC
low complexity region 1365 1380 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
C2 1488 1587 6.54e-11 SMART
C2 1728 1858 4.02e0 SMART
low complexity region 1903 1915 N/A INTRINSIC
transmembrane domain 1959 1981 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000133509
AA Change: R168H

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120591
Gene: ENSMUSG00000062372
AA Change: R168H

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 269 367 3.76e-11 SMART
FerI 353 424 7.91e-38 SMART
C2 432 543 1.75e-11 SMART
low complexity region 622 633 N/A INTRINSIC
FerB 856 932 5.13e-46 SMART
C2 975 1082 1.77e-7 SMART
Pfam:C2 1153 1236 1.4e-2 PFAM
low complexity region 1260 1271 N/A INTRINSIC
low complexity region 1288 1318 N/A INTRINSIC
low complexity region 1365 1380 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
C2 1488 1587 6.54e-11 SMART
C2 1728 1858 4.02e0 SMART
low complexity region 1903 1915 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144125
SMART Domains Protein: ENSMUSP00000120679
Gene: ENSMUSG00000062372

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 254 352 3.76e-11 SMART
FerI 338 409 7.91e-38 SMART
C2 417 528 1.75e-11 SMART
low complexity region 607 618 N/A INTRINSIC
FerB 841 917 5.13e-46 SMART
C2 960 1067 1.77e-7 SMART
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1265 1276 N/A INTRINSIC
low complexity region 1293 1323 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
low complexity region 1436 1447 N/A INTRINSIC
C2 1493 1592 6.54e-11 SMART
C2 1733 1863 4.02e0 SMART
Pfam:Ferlin_C 1895 1994 7.2e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150734
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are a cause of neurosensory nonsyndromic recessive deafness, DFNB9. The short form of the encoded protein has 3 C2 domains, a single carboxy-terminal transmembrane domain found also in the C. elegans spermatogenesis factor FER-1 and human dysferlin, while the long form has 6 C2 domains. The homology suggests that this protein may be involved in vesicle membrane fusion. Several transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have no detectable auditory brainstem response at any frequency tested. Otoacoustic transmission distortion products are detected. Direct electrical stimulation of cochlear ganglia elicits brainstem responses. On depolarization, inner hair cells release almost no neurotransmitter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T A 17: 9,008,013 S467T probably benign Het
2310030G06Rik A T 9: 50,740,723 Y68* probably null Het
4931408C20Rik T C 1: 26,685,359 T247A probably benign Het
9130019O22Rik T C 7: 127,385,007 S308G probably benign Het
Abat T G 16: 8,583,648 probably benign Het
Abca2 C T 2: 25,440,909 S1203F probably damaging Het
Adam22 G A 5: 8,136,813 P436L probably damaging Het
Ak3 A C 19: 29,047,732 L33R probably damaging Het
Arhgap11a A T 2: 113,842,029 I198K probably damaging Het
Arl14epl A T 18: 46,932,477 K103M possibly damaging Het
Atg16l1 T A 1: 87,766,174 N65K probably damaging Het
Btnl2 G A 17: 34,365,286 W394* probably null Het
Cacna1e C A 1: 154,421,058 R1687L probably damaging Het
Cacna1g G T 11: 94,459,607 R471S probably benign Het
Cdh13 A T 8: 118,851,848 R205* probably null Het
Cdkl3 A T 11: 52,005,034 Y36F probably damaging Het
Cep290 T A 10: 100,508,786 N488K probably damaging Het
Cep350 A T 1: 155,928,494 C948S probably benign Het
Cep70 A G 9: 99,296,085 K446R probably benign Het
Cfap70 T C 14: 20,425,529 T375A probably damaging Het
Cfhr1 A G 1: 139,560,133 L9S probably damaging Het
Chrm4 T A 2: 91,927,607 M120K probably damaging Het
Col1a1 A G 11: 94,950,095 probably null Het
Col3a1 T C 1: 45,323,803 probably null Het
Csrnp3 A T 2: 66,022,031 R256* probably null Het
Dbf4 T A 5: 8,408,263 K190* probably null Het
Dnah10 A T 5: 124,773,132 I1573F probably damaging Het
Dock8 A G 19: 25,169,494 I1446V probably benign Het
Dst G T 1: 34,190,862 R2187M probably damaging Het
Ece2 C T 16: 20,631,168 R257C probably damaging Het
Espn A G 4: 152,138,504 Y306H probably damaging Het
Fam208b G A 13: 3,584,807 P667S probably damaging Het
Fkbpl G A 17: 34,645,865 M202I probably benign Het
Fn1 A G 1: 71,642,083 L362P probably damaging Het
Ganc A C 2: 120,459,823 R880S probably benign Het
Gucy1b2 A T 14: 62,448,246 L90Q probably damaging Het
Hcn1 T A 13: 117,925,710 I504N unknown Het
Hdac2 C A 10: 36,997,466 T352K probably benign Het
Hip1 T C 5: 135,426,318 probably null Het
Hspa13 G A 16: 75,765,281 S10L probably damaging Het
Ipo5 T C 14: 120,920,038 I96T probably benign Het
Isl1 T C 13: 116,301,684 Y264C probably damaging Het
Izumo1 T C 7: 45,626,233 I322T probably benign Het
Kars A C 8: 112,002,526 V183G possibly damaging Het
Lrrc15 C A 16: 30,274,268 M84I probably benign Het
Magi1 A T 6: 93,694,196 V796E probably damaging Het
Matn4 G T 2: 164,400,976 D67E probably benign Het
Mertk A G 2: 128,782,576 M636V probably damaging Het
Mettl27 C A 5: 134,934,412 P126T probably damaging Het
Mfrp T A 9: 44,102,135 H52Q possibly damaging Het
Mrgprb8 T G 7: 48,388,908 I109R probably benign Het
Mroh2a G A 1: 88,237,944 G512S probably damaging Het
Ncoa7 T A 10: 30,722,659 R89S possibly damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nin G T 12: 70,090,551 H84N possibly damaging Het
Nwd2 A T 5: 63,805,550 I826F possibly damaging Het
Olfr195 A G 16: 59,149,030 Y60C probably damaging Het
Olfr299 T C 7: 86,465,909 F166S probably damaging Het
Olfr339 G A 2: 36,422,000 V201I probably benign Het
Olfr498 T C 7: 108,465,731 S136P probably benign Het
Olfr69 T C 7: 103,767,754 I214M possibly damaging Het
Olfr724 C T 14: 49,960,189 M294I probably benign Het
Olfr959 A G 9: 39,573,145 M38T probably benign Het
Pcdha6 T C 18: 36,968,432 V226A possibly damaging Het
Pggt1b T C 18: 46,258,099 I200V possibly damaging Het
Ppat G A 5: 76,950,964 Q41* probably null Het
Ppfibp2 A T 7: 107,742,985 H27L probably damaging Het
Rbm27 T A 18: 42,327,445 I775N probably damaging Het
Rnf40 C T 7: 127,592,640 R349* probably null Het
Rtp3 A T 9: 110,989,476 W46R probably damaging Het
Sass6 C T 3: 116,610,300 R196W probably damaging Het
Sel1l A T 12: 91,833,158 D131E probably benign Het
Slain2 T C 5: 72,948,723 S234P probably damaging Het
Slc47a1 C T 11: 61,373,350 probably null Het
Sp140 CAGAAGAAG CAGAAG 1: 85,610,808 probably benign Het
Spef2 A T 15: 9,713,178 Y369* probably null Het
Spred2 T A 11: 19,998,233 M76K possibly damaging Het
Svs2 T A 2: 164,236,886 D367V probably benign Het
Tefm A T 11: 80,137,121 D270E probably benign Het
Tfcp2l1 C A 1: 118,669,464 P425H probably benign Het
Thbd A T 2: 148,406,671 C426S probably damaging Het
Timm10b T A 7: 105,684,012 D968E probably damaging Het
Tle2 C T 10: 81,577,684 T119I probably damaging Het
Tnik T A 3: 28,596,075 Y446N possibly damaging Het
Tpr T A 1: 150,449,197 L2400* probably null Het
Trrap T C 5: 144,845,592 F3328S probably damaging Het
Vldlr G A 19: 27,238,065 C154Y probably damaging Het
Vmn1r79 T G 7: 12,176,434 M81R probably benign Het
Vps13d T C 4: 145,085,430 T3305A possibly damaging Het
Wdr62 T A 7: 30,241,465 I843F probably benign Het
Wdr62 T C 7: 30,270,686 E232G probably damaging Het
Zfp873 T A 10: 82,060,519 H361Q probably damaging Het
Zfp949 A C 9: 88,569,994 H539P probably damaging Het
Other mutations in Otof
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Otof APN 5 30375904 missense probably damaging 1.00
IGL00391:Otof APN 5 30375623 missense probably damaging 1.00
IGL00579:Otof APN 5 30399322 missense possibly damaging 0.88
IGL00671:Otof APN 5 30385753 critical splice donor site probably null
IGL01019:Otof APN 5 30405216 missense probably benign 0.01
IGL01025:Otof APN 5 30384253 missense possibly damaging 0.82
IGL01086:Otof APN 5 30376273 critical splice donor site probably null
IGL01110:Otof APN 5 30461725 missense probably damaging 1.00
IGL01160:Otof APN 5 30381535 missense probably benign 0.00
IGL01285:Otof APN 5 30405183 missense probably damaging 1.00
IGL01329:Otof APN 5 30441379 missense probably benign 0.00
IGL01337:Otof APN 5 30405777 missense possibly damaging 0.93
IGL01337:Otof APN 5 30419512 missense probably benign 0.17
IGL01834:Otof APN 5 30399220 missense probably damaging 1.00
IGL01872:Otof APN 5 30379254 splice site probably benign
IGL01969:Otof APN 5 30382483 splice site probably benign
IGL02075:Otof APN 5 30370726 missense probably benign 0.23
IGL02077:Otof APN 5 30399235 missense probably damaging 1.00
IGL02136:Otof APN 5 30373992 missense possibly damaging 0.90
IGL02227:Otof APN 5 30370784 missense probably damaging 1.00
IGL02475:Otof APN 5 30376682 missense probably damaging 1.00
IGL02812:Otof APN 5 30374082 missense probably benign 0.08
IGL02864:Otof APN 5 30386341 missense probably damaging 0.99
IGL03176:Otof APN 5 30405176 splice site probably null
R0285:Otof UTSW 5 30379533 critical splice donor site probably null
R0421:Otof UTSW 5 30371568 missense possibly damaging 0.94
R0570:Otof UTSW 5 30371881 splice site probably benign
R0599:Otof UTSW 5 30370705 missense probably damaging 1.00
R0675:Otof UTSW 5 30382361 missense probably benign 0.01
R0715:Otof UTSW 5 30394697 missense probably damaging 0.99
R1019:Otof UTSW 5 30370743 missense probably damaging 0.96
R1183:Otof UTSW 5 30371912 missense probably damaging 1.00
R1435:Otof UTSW 5 30378695 missense probably benign 0.00
R1469:Otof UTSW 5 30380227 missense probably benign 0.00
R1469:Otof UTSW 5 30380227 missense probably benign 0.00
R1474:Otof UTSW 5 30379532 critical splice donor site probably null
R1524:Otof UTSW 5 30379556 missense probably benign 0.03
R1563:Otof UTSW 5 30371005 missense probably benign 0.00
R1732:Otof UTSW 5 30386471 missense probably damaging 1.00
R1822:Otof UTSW 5 30378710 missense probably benign 0.00
R1845:Otof UTSW 5 30371723 nonsense probably null
R1925:Otof UTSW 5 30394188 missense probably benign 0.37
R1938:Otof UTSW 5 30376369 missense probably benign 0.00
R1968:Otof UTSW 5 30388654 missense probably damaging 1.00
R1996:Otof UTSW 5 30421037 missense probably benign 0.01
R1999:Otof UTSW 5 30388772 missense probably benign 0.19
R2027:Otof UTSW 5 30421014 missense probably benign 0.08
R2138:Otof UTSW 5 30461770 missense probably benign 0.01
R2173:Otof UTSW 5 30386374 missense probably damaging 1.00
R2245:Otof UTSW 5 30370207 missense probably damaging 1.00
R3011:Otof UTSW 5 30382840 missense probably damaging 1.00
R3105:Otof UTSW 5 30381801 missense probably benign 0.03
R3442:Otof UTSW 5 30371689 missense probably damaging 1.00
R3710:Otof UTSW 5 30385266 missense probably benign
R3715:Otof UTSW 5 30376871 nonsense probably null
R3806:Otof UTSW 5 30386499 critical splice acceptor site probably null
R3975:Otof UTSW 5 30370712 missense probably damaging 1.00
R4067:Otof UTSW 5 30399291 missense probably damaging 1.00
R4077:Otof UTSW 5 30419506 missense possibly damaging 0.89
R4166:Otof UTSW 5 30382418 missense probably damaging 1.00
R4451:Otof UTSW 5 30385164 missense possibly damaging 0.77
R4485:Otof UTSW 5 30375000 missense possibly damaging 0.77
R4600:Otof UTSW 5 30371900 missense probably damaging 1.00
R4646:Otof UTSW 5 30383570 missense possibly damaging 0.82
R4648:Otof UTSW 5 30383570 missense possibly damaging 0.82
R4669:Otof UTSW 5 30420974 critical splice donor site probably null
R4773:Otof UTSW 5 30394682 missense probably benign 0.05
R4907:Otof UTSW 5 30378661 critical splice donor site probably null
R4961:Otof UTSW 5 30383493 intron probably benign
R4991:Otof UTSW 5 30394181 missense probably damaging 1.00
R5015:Otof UTSW 5 30382894 missense probably damaging 1.00
R5036:Otof UTSW 5 30384439 missense possibly damaging 0.54
R5038:Otof UTSW 5 30384439 missense possibly damaging 0.54
R5253:Otof UTSW 5 30370139 missense probably damaging 1.00
R5336:Otof UTSW 5 30376720 missense probably benign 0.01
R5365:Otof UTSW 5 30381800 missense probably damaging 0.99
R5901:Otof UTSW 5 30374979 missense probably damaging 1.00
R6211:Otof UTSW 5 30371900 missense probably damaging 0.99
R6318:Otof UTSW 5 30414544 missense probably damaging 1.00
R6331:Otof UTSW 5 30371935 missense possibly damaging 0.94
R6671:Otof UTSW 5 30419533 missense probably benign
R6701:Otof UTSW 5 30370797 nonsense probably null
R6792:Otof UTSW 5 30375634 missense probably damaging 1.00
R6853:Otof UTSW 5 30388239 missense probably damaging 1.00
R6940:Otof UTSW 5 30371643 missense probably damaging 0.96
R7037:Otof UTSW 5 30381538 missense probably benign 0.32
R7060:Otof UTSW 5 30388356 missense possibly damaging 0.84
R7089:Otof UTSW 5 30371568 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCTCTCATTCTGGCTAGAGC -3'
(R):5'- TCATAGGGAGCGAAAGTGCC -3'

Sequencing Primer
(F):5'- CTCTGGTTGAGAGGCAGGTGAG -3'
(R):5'- CTTCAGACCAGCCTGAGCATG -3'
Posted On2016-03-01