Incidental Mutation 'R4839:Mettl27'
ID371622
Institutional Source Beutler Lab
Gene Symbol Mettl27
Ensembl Gene ENSMUSG00000040557
Gene Namemethyltransferase like 27
SynonymsWbscr27
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R4839 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location134932368-134942637 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 134934412 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 126 (P126T)
Ref Sequence ENSEMBL: ENSMUSP00000144170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047196] [ENSMUST00000068617] [ENSMUST00000111218] [ENSMUST00000111219] [ENSMUST00000111221] [ENSMUST00000136246] [ENSMUST00000201847]
Predicted Effect probably damaging
Transcript: ENSMUST00000047196
AA Change: P126T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039080
Gene: ENSMUSG00000040557
AA Change: P126T

DomainStartEndE-ValueType
Pfam:Ubie_methyltran 29 188 1.4e-11 PFAM
Pfam:Methyltransf_23 45 217 4.9e-13 PFAM
Pfam:MetW 62 165 6.4e-8 PFAM
Pfam:Methyltransf_18 67 169 4.7e-14 PFAM
Pfam:Methyltransf_31 67 215 1.4e-12 PFAM
Pfam:Methyltransf_25 71 162 1.4e-10 PFAM
Pfam:Methyltransf_12 72 164 1.8e-10 PFAM
Pfam:Methyltransf_11 72 166 2.1e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000068617
AA Change: P126T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067814
Gene: ENSMUSG00000040557
AA Change: P126T

DomainStartEndE-ValueType
Pfam:Methyltransf_23 46 185 9e-9 PFAM
Pfam:Methyltransf_18 67 164 3.8e-10 PFAM
Pfam:Methyltransf_11 72 148 9.6e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111218
AA Change: P126T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106849
Gene: ENSMUSG00000040557
AA Change: P126T

DomainStartEndE-ValueType
Pfam:Ubie_methyltran 29 188 1.4e-11 PFAM
Pfam:Methyltransf_23 46 219 6.2e-14 PFAM
Pfam:MetW 62 165 6.4e-8 PFAM
Pfam:Methyltransf_18 67 169 7.2e-15 PFAM
Pfam:Methyltransf_31 67 216 1e-12 PFAM
Pfam:Methyltransf_25 71 162 1.3e-10 PFAM
Pfam:Methyltransf_12 72 164 1.8e-10 PFAM
Pfam:Methyltransf_11 72 166 5.2e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111219
AA Change: P126T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106850
Gene: ENSMUSG00000040557
AA Change: P126T

DomainStartEndE-ValueType
Pfam:Ubie_methyltran 29 188 1.4e-11 PFAM
Pfam:Methyltransf_23 46 219 6.2e-14 PFAM
Pfam:MetW 62 165 6.4e-8 PFAM
Pfam:Methyltransf_18 67 169 7.2e-15 PFAM
Pfam:Methyltransf_31 67 216 1e-12 PFAM
Pfam:Methyltransf_25 71 162 1.3e-10 PFAM
Pfam:Methyltransf_12 72 164 1.8e-10 PFAM
Pfam:Methyltransf_11 72 166 5.2e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111221
AA Change: P126T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106852
Gene: ENSMUSG00000040557
AA Change: P126T

DomainStartEndE-ValueType
Pfam:Methyltransf_23 46 185 9e-9 PFAM
Pfam:Methyltransf_18 67 164 3.8e-10 PFAM
Pfam:Methyltransf_11 72 148 9.6e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000136246
AA Change: P126T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119451
Gene: ENSMUSG00000040557
AA Change: P126T

DomainStartEndE-ValueType
Pfam:Ubie_methyltran 28 116 1.2e-6 PFAM
Pfam:Methyltransf_23 45 123 1.3e-8 PFAM
Pfam:Methyltransf_18 67 127 2.5e-10 PFAM
Pfam:Methyltransf_11 72 127 5.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136815
Predicted Effect probably damaging
Transcript: ENSMUST00000201847
AA Change: P126T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144170
Gene: ENSMUSG00000040557
AA Change: P126T

DomainStartEndE-ValueType
Pfam:Ubie_methyltran 29 188 2.3e-9 PFAM
Pfam:Methyltransf_23 45 214 6.5e-11 PFAM
Pfam:MetW 62 165 8.7e-5 PFAM
Pfam:Methyltransf_18 67 169 4e-12 PFAM
Pfam:Methyltransf_31 67 215 1.1e-10 PFAM
Pfam:Methyltransf_25 71 162 1.6e-8 PFAM
Pfam:Methyltransf_12 72 164 2.7e-8 PFAM
Pfam:Methyltransf_11 72 166 1.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202228
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to ubiE/COQ5 methyltransferase family. The gene is deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.22-q11.23. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T A 17: 9,008,013 S467T probably benign Het
2310030G06Rik A T 9: 50,740,723 Y68* probably null Het
4931408C20Rik T C 1: 26,685,359 T247A probably benign Het
9130019O22Rik T C 7: 127,385,007 S308G probably benign Het
Abat T G 16: 8,583,648 probably benign Het
Abca2 C T 2: 25,440,909 S1203F probably damaging Het
Adam22 G A 5: 8,136,813 P436L probably damaging Het
Ak3 A C 19: 29,047,732 L33R probably damaging Het
Arhgap11a A T 2: 113,842,029 I198K probably damaging Het
Arl14epl A T 18: 46,932,477 K103M possibly damaging Het
Atg16l1 T A 1: 87,766,174 N65K probably damaging Het
Btnl2 G A 17: 34,365,286 W394* probably null Het
Cacna1e C A 1: 154,421,058 R1687L probably damaging Het
Cacna1g G T 11: 94,459,607 R471S probably benign Het
Cdh13 A T 8: 118,851,848 R205* probably null Het
Cdkl3 A T 11: 52,005,034 Y36F probably damaging Het
Cep290 T A 10: 100,508,786 N488K probably damaging Het
Cep350 A T 1: 155,928,494 C948S probably benign Het
Cep70 A G 9: 99,296,085 K446R probably benign Het
Cfap70 T C 14: 20,425,529 T375A probably damaging Het
Cfhr1 A G 1: 139,560,133 L9S probably damaging Het
Chrm4 T A 2: 91,927,607 M120K probably damaging Het
Col1a1 A G 11: 94,950,095 probably null Het
Col3a1 T C 1: 45,323,803 probably null Het
Csrnp3 A T 2: 66,022,031 R256* probably null Het
Dbf4 T A 5: 8,408,263 K190* probably null Het
Dnah10 A T 5: 124,773,132 I1573F probably damaging Het
Dock8 A G 19: 25,169,494 I1446V probably benign Het
Dst G T 1: 34,190,862 R2187M probably damaging Het
Ece2 C T 16: 20,631,168 R257C probably damaging Het
Espn A G 4: 152,138,504 Y306H probably damaging Het
Fam208b G A 13: 3,584,807 P667S probably damaging Het
Fkbpl G A 17: 34,645,865 M202I probably benign Het
Fn1 A G 1: 71,642,083 L362P probably damaging Het
Ganc A C 2: 120,459,823 R880S probably benign Het
Gucy1b2 A T 14: 62,448,246 L90Q probably damaging Het
Hcn1 T A 13: 117,925,710 I504N unknown Het
Hdac2 C A 10: 36,997,466 T352K probably benign Het
Hip1 T C 5: 135,426,318 probably null Het
Hspa13 G A 16: 75,765,281 S10L probably damaging Het
Ipo5 T C 14: 120,920,038 I96T probably benign Het
Isl1 T C 13: 116,301,684 Y264C probably damaging Het
Izumo1 T C 7: 45,626,233 I322T probably benign Het
Kars A C 8: 112,002,526 V183G possibly damaging Het
Lrrc15 C A 16: 30,274,268 M84I probably benign Het
Magi1 A T 6: 93,694,196 V796E probably damaging Het
Matn4 G T 2: 164,400,976 D67E probably benign Het
Mertk A G 2: 128,782,576 M636V probably damaging Het
Mfrp T A 9: 44,102,135 H52Q possibly damaging Het
Mrgprb8 T G 7: 48,388,908 I109R probably benign Het
Mroh2a G A 1: 88,237,944 G512S probably damaging Het
Ncoa7 T A 10: 30,722,659 R89S possibly damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nin G T 12: 70,090,551 H84N possibly damaging Het
Nwd2 A T 5: 63,805,550 I826F possibly damaging Het
Olfr195 A G 16: 59,149,030 Y60C probably damaging Het
Olfr299 T C 7: 86,465,909 F166S probably damaging Het
Olfr339 G A 2: 36,422,000 V201I probably benign Het
Olfr498 T C 7: 108,465,731 S136P probably benign Het
Olfr69 T C 7: 103,767,754 I214M possibly damaging Het
Olfr724 C T 14: 49,960,189 M294I probably benign Het
Olfr959 A G 9: 39,573,145 M38T probably benign Het
Otof C T 5: 30,419,404 R168H probably damaging Het
Pcdha6 T C 18: 36,968,432 V226A possibly damaging Het
Pggt1b T C 18: 46,258,099 I200V possibly damaging Het
Ppat G A 5: 76,950,964 Q41* probably null Het
Ppfibp2 A T 7: 107,742,985 H27L probably damaging Het
Rbm27 T A 18: 42,327,445 I775N probably damaging Het
Rnf40 C T 7: 127,592,640 R349* probably null Het
Rtp3 A T 9: 110,989,476 W46R probably damaging Het
Sass6 C T 3: 116,610,300 R196W probably damaging Het
Sel1l A T 12: 91,833,158 D131E probably benign Het
Slain2 T C 5: 72,948,723 S234P probably damaging Het
Slc47a1 C T 11: 61,373,350 probably null Het
Sp140 CAGAAGAAG CAGAAG 1: 85,610,808 probably benign Het
Spef2 A T 15: 9,713,178 Y369* probably null Het
Spred2 T A 11: 19,998,233 M76K possibly damaging Het
Svs2 T A 2: 164,236,886 D367V probably benign Het
Tefm A T 11: 80,137,121 D270E probably benign Het
Tfcp2l1 C A 1: 118,669,464 P425H probably benign Het
Thbd A T 2: 148,406,671 C426S probably damaging Het
Timm10b T A 7: 105,684,012 D968E probably damaging Het
Tle2 C T 10: 81,577,684 T119I probably damaging Het
Tnik T A 3: 28,596,075 Y446N possibly damaging Het
Tpr T A 1: 150,449,197 L2400* probably null Het
Trrap T C 5: 144,845,592 F3328S probably damaging Het
Vldlr G A 19: 27,238,065 C154Y probably damaging Het
Vmn1r79 T G 7: 12,176,434 M81R probably benign Het
Vps13d T C 4: 145,085,430 T3305A possibly damaging Het
Wdr62 T A 7: 30,241,465 I843F probably benign Het
Wdr62 T C 7: 30,270,686 E232G probably damaging Het
Zfp873 T A 10: 82,060,519 H361Q probably damaging Het
Zfp949 A C 9: 88,569,994 H539P probably damaging Het
Other mutations in Mettl27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Mettl27 APN 5 134935880 splice site probably benign
R0931:Mettl27 UTSW 5 134934431 splice site probably benign
R4039:Mettl27 UTSW 5 134940609 nonsense probably null
R6158:Mettl27 UTSW 5 134940576 missense possibly damaging 0.77
R7226:Mettl27 UTSW 5 134935803 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCTCATCCTCTACCTCAAGC -3'
(R):5'- TGGGATGTAGTAGAAGCCCAAC -3'

Sequencing Primer
(F):5'- TCCCAAGATCCAAGGAAGGGTC -3'
(R):5'- TGTAGTAGAAGCCCAACACTGTGC -3'
Posted On2016-03-01