Incidental Mutation 'R4839:Rnf40'
ID371638
Institutional Source Beutler Lab
Gene Symbol Rnf40
Ensembl Gene ENSMUSG00000030816
Gene Namering finger protein 40
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.913) question?
Stock #R4839 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location127588767-127604799 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 127592640 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 349 (R349*)
Ref Sequence ENSEMBL: ENSMUSP00000146310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033088] [ENSMUST00000072155] [ENSMUST00000205694] [ENSMUST00000206914]
Predicted Effect probably benign
Transcript: ENSMUST00000033088
SMART Domains Protein: ENSMUSP00000033088
Gene: ENSMUSG00000030816

DomainStartEndE-ValueType
coiled coil region 55 86 N/A INTRINSIC
coiled coil region 189 209 N/A INTRINSIC
coiled coil region 231 377 N/A INTRINSIC
coiled coil region 437 525 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
coiled coil region 629 760 N/A INTRINSIC
coiled coil region 800 839 N/A INTRINSIC
RING 948 986 1.86e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072155
SMART Domains Protein: ENSMUSP00000072019
Gene: ENSMUSG00000057176

DomainStartEndE-ValueType
Pfam:CLAMP 130 228 3.1e-37 PFAM
low complexity region 243 274 N/A INTRINSIC
coiled coil region 285 319 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000205694
AA Change: R349*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206724
Predicted Effect probably benign
Transcript: ENSMUST00000206914
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger, a motif known to be involved in protein-protein and protein-DNA interactions. This protein was reported to interact with the tumor suppressor protein RB1. Studies of the rat counterpart suggested that this protein may function as an E3 ubiquitin-protein ligase, and facilitate the ubiquitination and degradation of syntaxin 1, which is an essential component of the neurotransmitter release machinery. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T A 17: 9,008,013 S467T probably benign Het
2310030G06Rik A T 9: 50,740,723 Y68* probably null Het
4931408C20Rik T C 1: 26,685,359 T247A probably benign Het
9130019O22Rik T C 7: 127,385,007 S308G probably benign Het
Abat T G 16: 8,583,648 probably benign Het
Abca2 C T 2: 25,440,909 S1203F probably damaging Het
Adam22 G A 5: 8,136,813 P436L probably damaging Het
Ak3 A C 19: 29,047,732 L33R probably damaging Het
Arhgap11a A T 2: 113,842,029 I198K probably damaging Het
Arl14epl A T 18: 46,932,477 K103M possibly damaging Het
Atg16l1 T A 1: 87,766,174 N65K probably damaging Het
Btnl2 G A 17: 34,365,286 W394* probably null Het
Cacna1e C A 1: 154,421,058 R1687L probably damaging Het
Cacna1g G T 11: 94,459,607 R471S probably benign Het
Cdh13 A T 8: 118,851,848 R205* probably null Het
Cdkl3 A T 11: 52,005,034 Y36F probably damaging Het
Cep290 T A 10: 100,508,786 N488K probably damaging Het
Cep350 A T 1: 155,928,494 C948S probably benign Het
Cep70 A G 9: 99,296,085 K446R probably benign Het
Cfap70 T C 14: 20,425,529 T375A probably damaging Het
Cfhr1 A G 1: 139,560,133 L9S probably damaging Het
Chrm4 T A 2: 91,927,607 M120K probably damaging Het
Col1a1 A G 11: 94,950,095 probably null Het
Col3a1 T C 1: 45,323,803 probably null Het
Csrnp3 A T 2: 66,022,031 R256* probably null Het
Dbf4 T A 5: 8,408,263 K190* probably null Het
Dnah10 A T 5: 124,773,132 I1573F probably damaging Het
Dock8 A G 19: 25,169,494 I1446V probably benign Het
Dst G T 1: 34,190,862 R2187M probably damaging Het
Ece2 C T 16: 20,631,168 R257C probably damaging Het
Espn A G 4: 152,138,504 Y306H probably damaging Het
Fam208b G A 13: 3,584,807 P667S probably damaging Het
Fkbpl G A 17: 34,645,865 M202I probably benign Het
Fn1 A G 1: 71,642,083 L362P probably damaging Het
Ganc A C 2: 120,459,823 R880S probably benign Het
Gucy1b2 A T 14: 62,448,246 L90Q probably damaging Het
Hcn1 T A 13: 117,925,710 I504N unknown Het
Hdac2 C A 10: 36,997,466 T352K probably benign Het
Hip1 T C 5: 135,426,318 probably null Het
Hspa13 G A 16: 75,765,281 S10L probably damaging Het
Ipo5 T C 14: 120,920,038 I96T probably benign Het
Isl1 T C 13: 116,301,684 Y264C probably damaging Het
Izumo1 T C 7: 45,626,233 I322T probably benign Het
Kars A C 8: 112,002,526 V183G possibly damaging Het
Lrrc15 C A 16: 30,274,268 M84I probably benign Het
Magi1 A T 6: 93,694,196 V796E probably damaging Het
Matn4 G T 2: 164,400,976 D67E probably benign Het
Mertk A G 2: 128,782,576 M636V probably damaging Het
Mettl27 C A 5: 134,934,412 P126T probably damaging Het
Mfrp T A 9: 44,102,135 H52Q possibly damaging Het
Mrgprb8 T G 7: 48,388,908 I109R probably benign Het
Mroh2a G A 1: 88,237,944 G512S probably damaging Het
Ncoa7 T A 10: 30,722,659 R89S possibly damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nin G T 12: 70,090,551 H84N possibly damaging Het
Nwd2 A T 5: 63,805,550 I826F possibly damaging Het
Olfr195 A G 16: 59,149,030 Y60C probably damaging Het
Olfr299 T C 7: 86,465,909 F166S probably damaging Het
Olfr339 G A 2: 36,422,000 V201I probably benign Het
Olfr498 T C 7: 108,465,731 S136P probably benign Het
Olfr69 T C 7: 103,767,754 I214M possibly damaging Het
Olfr724 C T 14: 49,960,189 M294I probably benign Het
Olfr959 A G 9: 39,573,145 M38T probably benign Het
Otof C T 5: 30,419,404 R168H probably damaging Het
Pcdha6 T C 18: 36,968,432 V226A possibly damaging Het
Pggt1b T C 18: 46,258,099 I200V possibly damaging Het
Ppat G A 5: 76,950,964 Q41* probably null Het
Ppfibp2 A T 7: 107,742,985 H27L probably damaging Het
Rbm27 T A 18: 42,327,445 I775N probably damaging Het
Rtp3 A T 9: 110,989,476 W46R probably damaging Het
Sass6 C T 3: 116,610,300 R196W probably damaging Het
Sel1l A T 12: 91,833,158 D131E probably benign Het
Slain2 T C 5: 72,948,723 S234P probably damaging Het
Slc47a1 C T 11: 61,373,350 probably null Het
Sp140 CAGAAGAAG CAGAAG 1: 85,610,808 probably benign Het
Spef2 A T 15: 9,713,178 Y369* probably null Het
Spred2 T A 11: 19,998,233 M76K possibly damaging Het
Svs2 T A 2: 164,236,886 D367V probably benign Het
Tefm A T 11: 80,137,121 D270E probably benign Het
Tfcp2l1 C A 1: 118,669,464 P425H probably benign Het
Thbd A T 2: 148,406,671 C426S probably damaging Het
Timm10b T A 7: 105,684,012 D968E probably damaging Het
Tle2 C T 10: 81,577,684 T119I probably damaging Het
Tnik T A 3: 28,596,075 Y446N possibly damaging Het
Tpr T A 1: 150,449,197 L2400* probably null Het
Trrap T C 5: 144,845,592 F3328S probably damaging Het
Vldlr G A 19: 27,238,065 C154Y probably damaging Het
Vmn1r79 T G 7: 12,176,434 M81R probably benign Het
Vps13d T C 4: 145,085,430 T3305A possibly damaging Het
Wdr62 T A 7: 30,241,465 I843F probably benign Het
Wdr62 T C 7: 30,270,686 E232G probably damaging Het
Zfp873 T A 10: 82,060,519 H361Q probably damaging Het
Zfp949 A C 9: 88,569,994 H539P probably damaging Het
Other mutations in Rnf40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02155:Rnf40 APN 7 127590716 splice site probably benign
IGL02331:Rnf40 APN 7 127589827 missense probably benign
IGL02626:Rnf40 APN 7 127596572 missense probably damaging 1.00
IGL02867:Rnf40 APN 7 127591429 nonsense probably null
IGL02889:Rnf40 APN 7 127591429 nonsense probably null
IGL03353:Rnf40 APN 7 127592891 nonsense probably null
R0103:Rnf40 UTSW 7 127600571 missense probably damaging 1.00
R0103:Rnf40 UTSW 7 127600571 missense probably damaging 1.00
R0133:Rnf40 UTSW 7 127596860 synonymous probably null
R0554:Rnf40 UTSW 7 127602584 missense probably damaging 1.00
R0563:Rnf40 UTSW 7 127592876 missense probably damaging 1.00
R1523:Rnf40 UTSW 7 127590615 missense probably damaging 0.99
R1551:Rnf40 UTSW 7 127596334 missense possibly damaging 0.88
R1804:Rnf40 UTSW 7 127595948 missense possibly damaging 0.59
R1929:Rnf40 UTSW 7 127591784 missense probably damaging 0.99
R2194:Rnf40 UTSW 7 127597235 missense probably damaging 1.00
R2356:Rnf40 UTSW 7 127591576 missense probably damaging 0.99
R5071:Rnf40 UTSW 7 127597286 missense probably damaging 1.00
R5074:Rnf40 UTSW 7 127597286 missense probably damaging 1.00
R5292:Rnf40 UTSW 7 127595948 missense possibly damaging 0.59
R5537:Rnf40 UTSW 7 127596089 missense probably benign 0.05
R5547:Rnf40 UTSW 7 127589130 critical splice donor site probably null
R5871:Rnf40 UTSW 7 127591585 missense probably damaging 0.97
R6767:Rnf40 UTSW 7 127596585 missense possibly damaging 0.88
R6834:Rnf40 UTSW 7 127596406 missense probably benign 0.18
R6969:Rnf40 UTSW 7 127596323 missense possibly damaging 0.89
R6980:Rnf40 UTSW 7 127594677 missense probably damaging 1.00
X0026:Rnf40 UTSW 7 127594695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCTTAGAAAACGCATTGC -3'
(R):5'- GCAAAGACTCATTGTAGAGCAG -3'

Sequencing Primer
(F):5'- CCCTTAGAAAACGCATTGCTTTGG -3'
(R):5'- AGAACTGTGCCTGCAGC -3'
Posted On2016-03-01