Incidental Mutation 'R4839:Nfkb2'
ID371683
Institutional Source Beutler Lab
Gene Symbol Nfkb2
Ensembl Gene ENSMUSG00000025225
Gene Namenuclear factor of kappa light polypeptide gene enhancer in B cells 2, p49/p100
SynonymsNF kappaB2, p52
Accession Numbers

Genbank: NM_019408; MGI: 1099800

Is this an essential gene? Possibly non essential (E-score: 0.437) question?
Stock #R4839 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location46304737-46312090 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 46307567 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 170 (E170D)
Ref Sequence ENSEMBL: ENSMUSP00000107512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041391] [ENSMUST00000073116] [ENSMUST00000096029] [ENSMUST00000111881] [ENSMUST00000224556] [ENSMUST00000225323]
Predicted Effect probably benign
Transcript: ENSMUST00000041391
SMART Domains Protein: ENSMUSP00000039728
Gene: ENSMUSG00000037126

DomainStartEndE-ValueType
low complexity region 48 63 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 329 368 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
Sec7 519 708 5.08e-75 SMART
low complexity region 714 724 N/A INTRINSIC
low complexity region 736 744 N/A INTRINSIC
PH 757 871 1.87e-13 SMART
Blast:Sec7 900 952 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000073116
AA Change: E170D

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000072859
Gene: ENSMUSG00000025225
AA Change: E170D

DomainStartEndE-ValueType
Pfam:RHD_DNA_bind 40 220 1.3e-67 PFAM
IPT 227 326 3.48e-27 SMART
low complexity region 351 382 N/A INTRINSIC
low complexity region 391 409 N/A INTRINSIC
ANK 487 522 5.58e1 SMART
ANK 526 555 9.78e-4 SMART
ANK 559 591 3.74e0 SMART
ANK 599 628 3.36e-2 SMART
ANK 633 663 1.3e1 SMART
ANK 667 696 4.26e-4 SMART
low complexity region 707 721 N/A INTRINSIC
ANK 729 758 2.35e3 SMART
DEATH 764 851 5.52e-16 SMART
low complexity region 879 894 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096029
SMART Domains Protein: ENSMUSP00000093729
Gene: ENSMUSG00000037126

DomainStartEndE-ValueType
low complexity region 48 63 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 329 368 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
Sec7 520 709 5.08e-75 SMART
low complexity region 715 725 N/A INTRINSIC
low complexity region 737 745 N/A INTRINSIC
PH 758 872 1.87e-13 SMART
Blast:Sec7 901 953 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111881
AA Change: E170D

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000107512
Gene: ENSMUSG00000025225
AA Change: E170D

DomainStartEndE-ValueType
Pfam:RHD 40 220 1.3e-67 PFAM
IPT 227 326 3.48e-27 SMART
low complexity region 351 382 N/A INTRINSIC
low complexity region 391 409 N/A INTRINSIC
ANK 487 522 5.58e1 SMART
ANK 526 555 9.78e-4 SMART
ANK 559 591 3.74e0 SMART
ANK 599 628 3.36e-2 SMART
ANK 633 663 1.3e1 SMART
ANK 667 696 4.26e-4 SMART
low complexity region 707 721 N/A INTRINSIC
ANK 729 758 2.35e3 SMART
DEATH 764 851 5.52e-16 SMART
low complexity region 879 894 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224556
Predicted Effect probably benign
Transcript: ENSMUST00000225323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225748
Meta Mutation Damage Score 0.09 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the transcription factor complex nuclear factor-kappa-B (NFkB). The NFkB complex is expressed in numerous cell types and functions as a central activator of genes involved in inflammation and immune function. The protein encoded by this gene can function as both a transcriptional activator or repressor depending on its dimerization partner. The p100 full-length protein is co-translationally processed into a p52 active form. Chromosomal rearrangements and translocations of this locus have been observed in B cell lymphomas, some of which may result in the formation of fusion proteins. There is a pseudogene for this gene on chromosome 18. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit gastric hyperplasia, enlarged lymph nodes, enhanced cytokine production by activated T cells, absence of Peyer's patches, increased susceptibility to Leishmania major, and early postnatal mortality. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(5) Chemically induced(2)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T A 17: 9,008,013 S467T probably benign Het
2310030G06Rik A T 9: 50,740,723 Y68* probably null Het
4931408C20Rik T C 1: 26,685,359 T247A probably benign Het
9130019O22Rik T C 7: 127,385,007 S308G probably benign Het
Abat T G 16: 8,583,648 probably benign Het
Abca2 C T 2: 25,440,909 S1203F probably damaging Het
Adam22 G A 5: 8,136,813 P436L probably damaging Het
Ak3 A C 19: 29,047,732 L33R probably damaging Het
Arhgap11a A T 2: 113,842,029 I198K probably damaging Het
Arl14epl A T 18: 46,932,477 K103M possibly damaging Het
Atg16l1 T A 1: 87,766,174 N65K probably damaging Het
Btnl2 G A 17: 34,365,286 W394* probably null Het
Cacna1e C A 1: 154,421,058 R1687L probably damaging Het
Cacna1g G T 11: 94,459,607 R471S probably benign Het
Cdh13 A T 8: 118,851,848 R205* probably null Het
Cdkl3 A T 11: 52,005,034 Y36F probably damaging Het
Cep290 T A 10: 100,508,786 N488K probably damaging Het
Cep350 A T 1: 155,928,494 C948S probably benign Het
Cep70 A G 9: 99,296,085 K446R probably benign Het
Cfap70 T C 14: 20,425,529 T375A probably damaging Het
Cfhr1 A G 1: 139,560,133 L9S probably damaging Het
Chrm4 T A 2: 91,927,607 M120K probably damaging Het
Col1a1 A G 11: 94,950,095 probably null Het
Col3a1 T C 1: 45,323,803 probably null Het
Csrnp3 A T 2: 66,022,031 R256* probably null Het
Dbf4 T A 5: 8,408,263 K190* probably null Het
Dnah10 A T 5: 124,773,132 I1573F probably damaging Het
Dock8 A G 19: 25,169,494 I1446V probably benign Het
Dst G T 1: 34,190,862 R2187M probably damaging Het
Ece2 C T 16: 20,631,168 R257C probably damaging Het
Espn A G 4: 152,138,504 Y306H probably damaging Het
Fam208b G A 13: 3,584,807 P667S probably damaging Het
Fkbpl G A 17: 34,645,865 M202I probably benign Het
Fn1 A G 1: 71,642,083 L362P probably damaging Het
Ganc A C 2: 120,459,823 R880S probably benign Het
Gucy1b2 A T 14: 62,448,246 L90Q probably damaging Het
Hcn1 T A 13: 117,925,710 I504N unknown Het
Hdac2 C A 10: 36,997,466 T352K probably benign Het
Hip1 T C 5: 135,426,318 probably null Het
Hspa13 G A 16: 75,765,281 S10L probably damaging Het
Ipo5 T C 14: 120,920,038 I96T probably benign Het
Isl1 T C 13: 116,301,684 Y264C probably damaging Het
Izumo1 T C 7: 45,626,233 I322T probably benign Het
Kars A C 8: 112,002,526 V183G possibly damaging Het
Lrrc15 C A 16: 30,274,268 M84I probably benign Het
Magi1 A T 6: 93,694,196 V796E probably damaging Het
Matn4 G T 2: 164,400,976 D67E probably benign Het
Mertk A G 2: 128,782,576 M636V probably damaging Het
Mettl27 C A 5: 134,934,412 P126T probably damaging Het
Mfrp T A 9: 44,102,135 H52Q possibly damaging Het
Mrgprb8 T G 7: 48,388,908 I109R probably benign Het
Mroh2a G A 1: 88,237,944 G512S probably damaging Het
Ncoa7 T A 10: 30,722,659 R89S possibly damaging Het
Nin G T 12: 70,090,551 H84N possibly damaging Het
Nwd2 A T 5: 63,805,550 I826F possibly damaging Het
Olfr195 A G 16: 59,149,030 Y60C probably damaging Het
Olfr299 T C 7: 86,465,909 F166S probably damaging Het
Olfr339 G A 2: 36,422,000 V201I probably benign Het
Olfr498 T C 7: 108,465,731 S136P probably benign Het
Olfr69 T C 7: 103,767,754 I214M possibly damaging Het
Olfr724 C T 14: 49,960,189 M294I probably benign Het
Olfr959 A G 9: 39,573,145 M38T probably benign Het
Otof C T 5: 30,419,404 R168H probably damaging Het
Pcdha6 T C 18: 36,968,432 V226A possibly damaging Het
Pggt1b T C 18: 46,258,099 I200V possibly damaging Het
Ppat G A 5: 76,950,964 Q41* probably null Het
Ppfibp2 A T 7: 107,742,985 H27L probably damaging Het
Rbm27 T A 18: 42,327,445 I775N probably damaging Het
Rnf40 C T 7: 127,592,640 R349* probably null Het
Rtp3 A T 9: 110,989,476 W46R probably damaging Het
Sass6 C T 3: 116,610,300 R196W probably damaging Het
Sel1l A T 12: 91,833,158 D131E probably benign Het
Slain2 T C 5: 72,948,723 S234P probably damaging Het
Slc47a1 C T 11: 61,373,350 probably null Het
Sp140 CAGAAGAAG CAGAAG 1: 85,610,808 probably benign Het
Spef2 A T 15: 9,713,178 Y369* probably null Het
Spred2 T A 11: 19,998,233 M76K possibly damaging Het
Svs2 T A 2: 164,236,886 D367V probably benign Het
Tefm A T 11: 80,137,121 D270E probably benign Het
Tfcp2l1 C A 1: 118,669,464 P425H probably benign Het
Thbd A T 2: 148,406,671 C426S probably damaging Het
Timm10b T A 7: 105,684,012 D968E probably damaging Het
Tle2 C T 10: 81,577,684 T119I probably damaging Het
Tnik T A 3: 28,596,075 Y446N possibly damaging Het
Tpr T A 1: 150,449,197 L2400* probably null Het
Trrap T C 5: 144,845,592 F3328S probably damaging Het
Vldlr G A 19: 27,238,065 C154Y probably damaging Het
Vmn1r79 T G 7: 12,176,434 M81R probably benign Het
Vps13d T C 4: 145,085,430 T3305A possibly damaging Het
Wdr62 T A 7: 30,241,465 I843F probably benign Het
Wdr62 T C 7: 30,270,686 E232G probably damaging Het
Zfp873 T A 10: 82,060,519 H361Q probably damaging Het
Zfp949 A C 9: 88,569,994 H539P probably damaging Het
Other mutations in Nfkb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
xander APN 19 splice acceptor site
IGL01466:Nfkb2 APN 19 46308016 missense probably damaging 0.96
IGL01791:Nfkb2 APN 19 46309839 unclassified probably benign
IGL01966:Nfkb2 APN 19 46309690 missense probably benign 0.04
IGL03296:Nfkb2 APN 19 46309928 missense probably damaging 1.00
humbert UTSW 19 46307441 missense possibly damaging 0.86
lolita UTSW 19 46307720 critical splice donor site probably null
Nabukov UTSW 19 46308439 missense probably damaging 0.99
pale_fire UTSW 19 46311626 missense possibly damaging 0.96
R0270:Nfkb2 UTSW 19 46311626 missense possibly damaging 0.96
R0561:Nfkb2 UTSW 19 46309862 missense possibly damaging 0.93
R1944:Nfkb2 UTSW 19 46308052 missense probably damaging 1.00
R2217:Nfkb2 UTSW 19 46307724 splice site probably null
R2878:Nfkb2 UTSW 19 46307441 missense possibly damaging 0.86
R4493:Nfkb2 UTSW 19 46308439 missense probably damaging 0.99
R4494:Nfkb2 UTSW 19 46308439 missense probably damaging 0.99
R4495:Nfkb2 UTSW 19 46308439 missense probably damaging 0.99
R4731:Nfkb2 UTSW 19 46308964 missense possibly damaging 0.74
R4752:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R4753:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R4777:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R4780:Nfkb2 UTSW 19 46309922 missense probably damaging 1.00
R4820:Nfkb2 UTSW 19 46308054 missense probably damaging 0.99
R4837:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R5514:Nfkb2 UTSW 19 46311408 missense probably damaging 1.00
R5519:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R5549:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R5615:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R5616:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R5709:Nfkb2 UTSW 19 46310521 missense probably damaging 1.00
R6053:Nfkb2 UTSW 19 46311812 missense probably damaging 1.00
R6794:Nfkb2 UTSW 19 46307720 critical splice donor site probably null
S24628:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AATCTGGGTGTCCTGCATGTAAC -3'
(R):5'- ATCTCAAGCGCTCTTTTGGG -3'

Sequencing Primer
(F):5'- TGTCCTGCATGTAACCAAGAAG -3'
(R):5'- CAAGCGCTCTTTTGGGAATGC -3'
Posted On2016-03-01