Incidental Mutation 'R4840:Thsd7b'
ID371687
Institutional Source Beutler Lab
Gene Symbol Thsd7b
Ensembl Gene ENSMUSG00000042581
Gene Namethrombospondin, type I, domain containing 7B
Synonyms1700074E13Rik, D130067I03Rik
MMRRC Submission 042453-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.309) question?
Stock #R4840 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location129273302-130219278 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129595844 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 128 (V128A)
Ref Sequence ENSEMBL: ENSMUSP00000117750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040311] [ENSMUST00000073527] [ENSMUST00000152305]
Predicted Effect probably benign
Transcript: ENSMUST00000040311
AA Change: V205A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000041716
Gene: ENSMUSG00000042581
AA Change: V205A

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Blast:TSP1 43 98 3e-29 BLAST
Blast:TSP1 122 177 7e-24 BLAST
TSP1 182 233 2.47e-9 SMART
Blast:TSP1 290 338 1e-20 BLAST
TSP1 339 399 7e-9 SMART
Blast:TSP1 402 482 1e-27 BLAST
TSP1 487 543 2.12e-1 SMART
TSP1 604 661 3.9e-7 SMART
TSP1 664 735 2.73e-2 SMART
TSP1 740 796 1.01e-5 SMART
Blast:TSP1 799 869 4e-35 BLAST
TSP1 874 922 9.68e-3 SMART
TSP1 952 999 2.42e0 SMART
TSP1 1004 1051 1.15e-4 SMART
transmembrane domain 1070 1092 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073527
AA Change: V205A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073220
Gene: ENSMUSG00000042581
AA Change: V205A

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Blast:TSP1 43 98 5e-29 BLAST
Blast:TSP1 122 177 9e-24 BLAST
TSP1 182 233 2.47e-9 SMART
TSP1 339 399 7e-9 SMART
Blast:TSP1 402 482 2e-27 BLAST
TSP1 487 543 2.12e-1 SMART
TSP1 604 661 3.9e-7 SMART
TSP1 664 735 2.73e-2 SMART
TSP1 740 796 1.01e-5 SMART
Blast:TSP1 799 869 6e-35 BLAST
TSP1 874 922 9.68e-3 SMART
TSP1 952 999 2.42e0 SMART
TSP1 1004 1059 3.96e-8 SMART
TSP1 1062 1126 1.73e0 SMART
TSP1 1131 1182 6.05e-4 SMART
TSP1 1185 1246 9.52e-1 SMART
TSP1 1251 1303 3.21e-8 SMART
TSP1 1304 1369 5.52e-1 SMART
TSP1 1374 1432 3.92e-2 SMART
transmembrane domain 1558 1580 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140629
Predicted Effect probably benign
Transcript: ENSMUST00000152305
AA Change: V128A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117750
Gene: ENSMUSG00000042581
AA Change: V128A

DomainStartEndE-ValueType
Blast:TSP1 45 100 8e-25 BLAST
TSP1 105 156 2.47e-9 SMART
Blast:TSP1 213 261 2e-21 BLAST
TSP1 262 322 7e-9 SMART
Blast:TSP1 325 379 1e-13 BLAST
Meta Mutation Damage Score 0.104 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 97% (114/117)
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik C A 1: 86,046,444 T161K probably benign Het
Actn3 G A 19: 4,864,511 R530W probably damaging Het
Alg11 C T 8: 22,068,010 A404V possibly damaging Het
Alkbh8 T A 9: 3,369,751 V340D probably damaging Het
Arhgef12 T C 9: 42,975,068 H1166R probably benign Het
Aspm T A 1: 139,470,531 D978E possibly damaging Het
Bod1l C T 5: 41,818,472 G1833D probably damaging Het
Brd3 A G 2: 27,449,239 V676A possibly damaging Het
Brip1 G A 11: 86,146,183 T454I possibly damaging Het
C3ar1 T C 6: 122,850,764 I165V probably benign Het
C87977 T C 4: 144,208,574 K199R probably damaging Het
Camta1 T A 4: 151,144,407 Q656L probably benign Het
Casp14 A T 10: 78,713,344 L256* probably null Het
Cdh23 G T 10: 60,419,777 H773Q possibly damaging Het
Chd1 G A 17: 15,768,753 W1589* probably null Het
Chd1 G T 17: 15,768,754 D1590Y probably damaging Het
Cldn19 A G 4: 119,255,754 Q61R probably damaging Het
Cyp2a22 A G 7: 26,932,524 S436P probably benign Het
E130218I03Rik A G 4: 134,245,276 probably benign Het
Emc10 A C 7: 44,492,627 V124G probably damaging Het
Enam A T 5: 88,503,026 D723V probably benign Het
Eps8 C A 6: 137,527,130 Q158H probably damaging Het
Ercc6 G A 14: 32,541,296 D486N probably damaging Het
Fasn T C 11: 120,813,059 E1485G possibly damaging Het
Fat2 T C 11: 55,279,018 K2972E probably benign Het
Fbxw28 T C 9: 109,339,534 K30R probably null Het
Flot2 T A 11: 78,057,513 L164Q probably damaging Het
Fsip2 A T 2: 82,949,395 I162L probably benign Het
Fsip2 A T 2: 82,985,471 L3849F probably benign Het
Gabrb1 C G 5: 71,700,811 P60R probably damaging Het
Galnt14 T C 17: 73,504,898 R443G probably benign Het
Gas8 C T 8: 123,531,014 T400M probably benign Het
Gfap T C 11: 102,894,388 Y254C probably damaging Het
Git2 A G 5: 114,745,482 S396P probably damaging Het
Glb1l3 A T 9: 26,829,053 M327K probably benign Het
Gm10715 A C 9: 3,038,062 probably benign Het
Gm10787 G A 10: 77,022,007 noncoding transcript Het
Gm1123 T A 9: 99,018,569 D78V probably damaging Het
Gm27013 T C 6: 130,678,116 T128A probably benign Het
Gm8979 T C 7: 106,081,420 noncoding transcript Het
Gpbp1 A G 13: 111,440,630 probably null Het
Gphn G A 12: 78,522,955 probably null Het
Gpr157 A G 4: 150,102,366 E317G probably benign Het
Gsdmc4 T A 15: 63,893,747 M318L probably benign Het
Gtf2f2 A T 14: 76,010,691 W19R probably damaging Het
Helb A G 10: 120,084,858 V1060A probably benign Het
Igfn1 C T 1: 135,968,040 G1596D probably benign Het
Il1rl2 T C 1: 40,327,387 I27T possibly damaging Het
Inpp5j A G 11: 3,499,676 V702A probably damaging Het
Kmt2d A C 15: 98,861,894 V1161G unknown Het
Krtap1-3 T G 11: 99,590,889 Y144S possibly damaging Het
Layn C T 9: 51,057,382 V354M probably damaging Het
Lrba G A 3: 86,619,509 probably null Het
Lrp8 T A 4: 107,870,037 L893Q possibly damaging Het
Mrps9 T A 1: 42,898,415 probably benign Het
Mug1 T A 6: 121,885,854 M1387K probably damaging Het
Myo18b A C 5: 112,874,029 V499G probably benign Het
Nbea T C 3: 55,710,670 E2321G probably benign Het
Nrsn2 C T 2: 152,369,632 V160I probably benign Het
Nup210 G A 6: 91,031,668 Q510* probably null Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr693 T G 7: 106,678,123 D121A probably damaging Het
P3h3 G T 6: 124,850,637 Q479K possibly damaging Het
Paqr9 T A 9: 95,560,670 F238I probably damaging Het
Parp3 A T 9: 106,473,109 L343H probably damaging Het
Pcdh18 A C 3: 49,744,668 M1115R probably damaging Het
Pcdh8 A G 14: 79,770,868 V85A possibly damaging Het
Pcdhb4 A G 18: 37,308,399 N254S possibly damaging Het
Pld1 T C 3: 28,076,551 V500A probably benign Het
Prkg2 A T 5: 98,981,143 D311E probably benign Het
Prss42 T C 9: 110,799,301 L171P probably damaging Het
Pth2 T A 7: 45,181,343 L17H probably damaging Het
Reln A T 5: 22,018,846 probably null Het
Rmi2 G T 16: 10,839,837 V104L probably damaging Het
Rpusd4 T A 9: 35,268,535 V108D probably damaging Het
Rufy4 C A 1: 74,129,039 T82K possibly damaging Het
Scimp G A 11: 70,791,468 Q141* probably null Het
Sel1l2 T C 2: 140,263,470 T267A probably benign Het
Sema5a T A 15: 32,550,254 S146R possibly damaging Het
Sh2d3c T C 2: 32,721,160 M1T probably null Het
Slc30a6 T C 17: 74,405,721 L71P probably damaging Het
Srrm3 A G 5: 135,854,595 Y224C possibly damaging Het
Tacr3 A T 3: 134,854,854 T185S possibly damaging Het
Tas2r140 T A 6: 133,055,565 T77S probably benign Het
Tnfrsf10b T G 14: 69,776,159 H179Q probably damaging Het
Tonsl A G 15: 76,633,209 V770A probably benign Het
Trim42 G A 9: 97,362,929 P606L probably benign Het
Trim45 A T 3: 100,925,488 T346S possibly damaging Het
Ttc28 C A 5: 111,286,081 S2296Y probably damaging Het
Ttc41 C T 10: 86,731,125 R552C probably benign Het
Tube1 A G 10: 39,144,846 N243D probably benign Het
Tvp23b G T 11: 62,879,598 probably null Het
Ubxn11 T A 4: 134,109,608 I49N probably damaging Het
Usp17le T A 7: 104,769,770 E55V probably benign Het
Vmn2r114 A T 17: 23,291,379 V709D probably damaging Het
Vmn2r23 C T 6: 123,713,074 T303M probably damaging Het
Vmn2r60 C T 7: 42,135,861 P166S probably damaging Het
Vmn2r83 A G 10: 79,477,848 I97V possibly damaging Het
Vmn2r-ps159 G C 4: 156,333,438 noncoding transcript Het
Wbp2nl A T 15: 82,314,336 K358M possibly damaging Het
Xpo1 T A 11: 23,278,183 I150N probably damaging Het
Zfp113 G A 5: 138,145,425 L188F probably damaging Het
Zfp189 T G 4: 49,529,984 S362R probably damaging Het
Other mutations in Thsd7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Thsd7b APN 1 129595834 missense probably damaging 1.00
IGL00850:Thsd7b APN 1 130165077 missense probably benign 0.00
IGL00987:Thsd7b APN 1 129613279 missense probably damaging 1.00
IGL01068:Thsd7b APN 1 129596146 missense probably damaging 1.00
IGL01091:Thsd7b APN 1 129776334 missense probably benign 0.29
IGL01535:Thsd7b APN 1 129678217 missense possibly damaging 0.64
IGL01560:Thsd7b APN 1 130218181 utr 3 prime probably benign
IGL01701:Thsd7b APN 1 129430928 missense probably benign 0.07
IGL01775:Thsd7b APN 1 129628939 missense probably damaging 0.99
IGL02077:Thsd7b APN 1 129816682 missense probably damaging 1.00
IGL02338:Thsd7b APN 1 129595771 missense probably damaging 1.00
IGL02340:Thsd7b APN 1 130159632 missense probably benign 0.01
IGL02404:Thsd7b APN 1 129613151 missense probably damaging 1.00
IGL02519:Thsd7b APN 1 129613195 missense probably benign 0.22
IGL02543:Thsd7b APN 1 130165103 missense probably benign 0.03
IGL02740:Thsd7b APN 1 129613127 missense probably damaging 0.99
IGL02793:Thsd7b APN 1 129951393 missense probably damaging 1.00
IGL02875:Thsd7b APN 1 129951393 missense probably damaging 1.00
IGL02986:Thsd7b APN 1 129915615 missense probably benign 0.01
IGL03108:Thsd7b APN 1 130210276 missense probably damaging 1.00
IGL03114:Thsd7b APN 1 130188551 missense probably benign 0.00
IGL03195:Thsd7b APN 1 129628909 missense probably damaging 1.00
IGL03291:Thsd7b APN 1 129760355 missense possibly damaging 0.94
IGL03397:Thsd7b APN 1 129596164 missense probably benign 0.17
IGL03399:Thsd7b APN 1 129628885 missense probably damaging 1.00
R0184:Thsd7b UTSW 1 129430964 missense probably benign 0.00
R0277:Thsd7b UTSW 1 130195263 missense probably benign 0.00
R0526:Thsd7b UTSW 1 129951392 missense probably damaging 1.00
R0633:Thsd7b UTSW 1 130188526 missense possibly damaging 0.78
R0746:Thsd7b UTSW 1 130188531 missense probably benign 0.00
R0784:Thsd7b UTSW 1 129595359 splice site probably benign
R1158:Thsd7b UTSW 1 130189935 synonymous probably null
R1267:Thsd7b UTSW 1 129628840 intron probably null
R1375:Thsd7b UTSW 1 130159686 missense probably damaging 1.00
R1565:Thsd7b UTSW 1 129596041 missense possibly damaging 0.94
R1728:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1728:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1728:Thsd7b UTSW 1 129678183 missense probably benign
R1728:Thsd7b UTSW 1 130116631 missense probably benign
R1729:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1729:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1729:Thsd7b UTSW 1 129678183 missense probably benign
R1729:Thsd7b UTSW 1 130116631 missense probably benign
R1730:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1730:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1730:Thsd7b UTSW 1 129678183 missense probably benign
R1730:Thsd7b UTSW 1 130116631 missense probably benign
R1739:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1739:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1739:Thsd7b UTSW 1 129678183 missense probably benign
R1739:Thsd7b UTSW 1 130116631 missense probably benign
R1762:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1762:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1762:Thsd7b UTSW 1 129678183 missense probably benign
R1762:Thsd7b UTSW 1 130103076 missense possibly damaging 0.92
R1762:Thsd7b UTSW 1 130116631 missense probably benign
R1783:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1783:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1783:Thsd7b UTSW 1 129678183 missense probably benign
R1783:Thsd7b UTSW 1 130116631 missense probably benign
R1784:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1784:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1784:Thsd7b UTSW 1 129678183 missense probably benign
R1784:Thsd7b UTSW 1 130116631 missense probably benign
R1785:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1785:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1785:Thsd7b UTSW 1 129678183 missense probably benign
R1785:Thsd7b UTSW 1 130116631 missense probably benign
R1812:Thsd7b UTSW 1 129758610 missense probably damaging 1.00
R1846:Thsd7b UTSW 1 129613256 missense probably damaging 1.00
R1908:Thsd7b UTSW 1 129678109 missense probably damaging 0.99
R1996:Thsd7b UTSW 1 129758451 nonsense probably null
R2199:Thsd7b UTSW 1 130218158 missense probably benign 0.04
R2483:Thsd7b UTSW 1 130103072 missense probably damaging 1.00
R2919:Thsd7b UTSW 1 130189850 splice site probably benign
R2935:Thsd7b UTSW 1 129678087 missense possibly damaging 0.83
R3113:Thsd7b UTSW 1 130049862 missense probably benign 0.23
R3236:Thsd7b UTSW 1 130218118 nonsense probably null
R3745:Thsd7b UTSW 1 129678241 missense probably benign 0.04
R3877:Thsd7b UTSW 1 130190182 missense possibly damaging 0.92
R3880:Thsd7b UTSW 1 129595370 missense probably damaging 1.00
R4110:Thsd7b UTSW 1 130116619 missense probably benign 0.18
R4112:Thsd7b UTSW 1 130116619 missense probably benign 0.18
R4255:Thsd7b UTSW 1 129760287 missense possibly damaging 0.79
R4621:Thsd7b UTSW 1 129430915 missense possibly damaging 0.47
R4703:Thsd7b UTSW 1 130049909 intron probably benign
R4732:Thsd7b UTSW 1 129613186 missense probably damaging 1.00
R4733:Thsd7b UTSW 1 129613186 missense probably damaging 1.00
R4755:Thsd7b UTSW 1 130210264 missense probably benign 0.01
R4805:Thsd7b UTSW 1 130188539 missense probably benign 0.04
R4879:Thsd7b UTSW 1 130188499 missense possibly damaging 0.62
R4936:Thsd7b UTSW 1 129678145 missense probably benign 0.00
R4972:Thsd7b UTSW 1 130188572 missense probably damaging 0.97
R5304:Thsd7b UTSW 1 129678243 nonsense probably null
R5422:Thsd7b UTSW 1 129921334 missense probably benign 0.41
R5495:Thsd7b UTSW 1 129595833 missense probably damaging 1.00
R5598:Thsd7b UTSW 1 129595841 missense probably damaging 1.00
R5620:Thsd7b UTSW 1 130162936 critical splice donor site probably null
R5638:Thsd7b UTSW 1 129595533 missense probably benign 0.00
R5640:Thsd7b UTSW 1 130116671 nonsense probably null
R5655:Thsd7b UTSW 1 129628934 synonymous probably null
R5711:Thsd7b UTSW 1 129760402 missense probably damaging 1.00
R5823:Thsd7b UTSW 1 129678084 missense probably benign 0.00
R5888:Thsd7b UTSW 1 130210320 nonsense probably null
R5932:Thsd7b UTSW 1 129430838 missense probably benign
R6243:Thsd7b UTSW 1 130162862 missense probably benign 0.21
R6258:Thsd7b UTSW 1 129667918 missense probably benign
R6260:Thsd7b UTSW 1 129667918 missense probably benign
R6399:Thsd7b UTSW 1 129816648 missense probably benign 0.13
R6437:Thsd7b UTSW 1 129816682 missense probably damaging 1.00
R6719:Thsd7b UTSW 1 130159714 splice site probably null
R6785:Thsd7b UTSW 1 129430907 missense probably damaging 0.99
X0027:Thsd7b UTSW 1 129596072 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGGAATGTGTGACTGCAC -3'
(R):5'- CTGAGGTCGACTTCCTTAAGGTG -3'

Sequencing Primer
(F):5'- GCGCTGTCTTCAGAAGCTCAATAG -3'
(R):5'- GAGGGAGTCTACATTTGCTCC -3'
Posted On2016-03-01