Incidental Mutation 'R4840:Aspm'
ID371689
Institutional Source Beutler Lab
Gene Symbol Aspm
Ensembl Gene ENSMUSG00000033952
Gene Nameabnormal spindle microtubule assembly
SynonymsAspm, Sha1, MCPH5, D330028K02Rik, Calmbp1
MMRRC Submission 042453-MU
Accession Numbers

Genbank: NM_009791; MGI: 1334448

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4840 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location139454772-139494091 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 139470531 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 978 (D978E)
Ref Sequence ENSEMBL: ENSMUSP00000142880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053364] [ENSMUST00000200083]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053364
AA Change: D978E

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000059159
Gene: ENSMUSG00000033952
AA Change: D978E

DomainStartEndE-ValueType
Pfam:ASH 29 126 8.9e-35 PFAM
low complexity region 855 861 N/A INTRINSIC
CH 890 1022 2.04e0 SMART
CH 1080 1224 5.56e-9 SMART
IQ 1233 1255 7.57e0 SMART
IQ 1259 1281 1.12e1 SMART
IQ 1282 1304 3.73e-1 SMART
IQ 1314 1336 2.41e-4 SMART
IQ 1360 1382 2.12e1 SMART
IQ 1387 1408 7.61e1 SMART
IQ 1409 1431 6.97e0 SMART
IQ 1432 1452 1.44e1 SMART
IQ 1453 1475 1.15e-1 SMART
IQ 1476 1495 1.66e2 SMART
IQ 1503 1525 1.65e-2 SMART
IQ 1526 1548 1.32e1 SMART
IQ 1549 1571 1.48e1 SMART
IQ 1572 1594 2.5e1 SMART
IQ 1599 1621 2.58e-4 SMART
IQ 1622 1644 6.7e-3 SMART
IQ 1645 1667 4.25e1 SMART
IQ 1668 1694 1.03e2 SMART
IQ 1695 1717 2.33e-2 SMART
IQ 1718 1740 7.79e0 SMART
IQ 1741 1763 1.57e2 SMART
IQ 1768 1790 2.68e-2 SMART
IQ 1791 1813 5.83e-3 SMART
IQ 1814 1836 5.93e1 SMART
IQ 1841 1863 1.92e-3 SMART
IQ 1864 1886 3.79e-2 SMART
IQ 1914 1936 4.11e0 SMART
IQ 1937 1959 1.87e-1 SMART
IQ 1960 1982 6.27e1 SMART
IQ 1987 2009 8.25e-3 SMART
IQ 2010 2032 5.73e0 SMART
IQ 2060 2082 1.39e0 SMART
IQ 2083 2105 4.62e1 SMART
IQ 2133 2155 5.58e0 SMART
IQ 2156 2178 7.07e-2 SMART
IQ 2206 2228 1.18e-3 SMART
IQ 2229 2251 4.59e0 SMART
IQ 2278 2300 1.85e-5 SMART
IQ 2301 2323 8.13e-2 SMART
IQ 2342 2364 9.62e-4 SMART
IQ 2365 2387 4.12e-3 SMART
IQ 2415 2437 7.58e-2 SMART
IQ 2438 2460 2.6e0 SMART
IQ 2490 2512 1.68e-3 SMART
IQ 2513 2535 8.51e1 SMART
IQ 2560 2582 2.14e-1 SMART
IQ 2601 2623 8.46e0 SMART
IQ 2647 2669 1.15e1 SMART
IQ 2673 2695 1.95e-4 SMART
IQ 2696 2718 4.13e1 SMART
IQ 2723 2745 1.02e-2 SMART
IQ 2761 2783 3.14e2 SMART
IQ 2784 2806 1e1 SMART
IQ 2825 2847 2.43e0 SMART
IQ 2848 2870 4.6e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199998
Predicted Effect possibly damaging
Transcript: ENSMUST00000200083
AA Change: D978E

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142880
Gene: ENSMUSG00000033952
AA Change: D978E

DomainStartEndE-ValueType
low complexity region 855 861 N/A INTRINSIC
CH 890 1022 2.04e0 SMART
CH 1080 1224 5.56e-9 SMART
IQ 1233 1255 7.57e0 SMART
IQ 1259 1281 1.12e1 SMART
IQ 1282 1304 3.73e-1 SMART
IQ 1314 1336 1.25e1 SMART
IQ 1337 1358 2.96e1 SMART
IQ 1382 1404 1.15e1 SMART
IQ 1408 1430 1.95e-4 SMART
IQ 1431 1453 4.13e1 SMART
IQ 1458 1480 1.02e-2 SMART
IQ 1496 1518 3.14e2 SMART
IQ 1519 1541 1e1 SMART
IQ 1560 1582 2.43e0 SMART
IQ 1583 1605 4.6e-1 SMART
Meta Mutation Damage Score 0.0848 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 97% (114/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the human ortholog of the Drosophila melanogaster 'abnormal spindle' gene (asp), which is essential for normal mitotic spindle function in embryonic neuroblasts. Studies in mouse also suggest a role of this gene in mitotic spindle regulation, with a preferential role in regulating neurogenesis. Mutations in this gene are associated with microcephaly primary type 5. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for protein-truncating gene trap mutations of this gene exhibit decreased body weight, microcephaly, a severe reduction in brain, testis and ovary weight, oligozoospermia and asthenospermia, and reduced fertility in both sexes. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(2) Gene trapped(7)

Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik C A 1: 86,046,444 T161K probably benign Het
Actn3 G A 19: 4,864,511 R530W probably damaging Het
Alg11 C T 8: 22,068,010 A404V possibly damaging Het
Alkbh8 T A 9: 3,369,751 V340D probably damaging Het
Arhgef12 T C 9: 42,975,068 H1166R probably benign Het
Bod1l C T 5: 41,818,472 G1833D probably damaging Het
Brd3 A G 2: 27,449,239 V676A possibly damaging Het
Brip1 G A 11: 86,146,183 T454I possibly damaging Het
C3ar1 T C 6: 122,850,764 I165V probably benign Het
C87977 T C 4: 144,208,574 K199R probably damaging Het
Camta1 T A 4: 151,144,407 Q656L probably benign Het
Casp14 A T 10: 78,713,344 L256* probably null Het
Cdh23 G T 10: 60,419,777 H773Q possibly damaging Het
Chd1 G A 17: 15,768,753 W1589* probably null Het
Chd1 G T 17: 15,768,754 D1590Y probably damaging Het
Cldn19 A G 4: 119,255,754 Q61R probably damaging Het
Cyp2a22 A G 7: 26,932,524 S436P probably benign Het
E130218I03Rik A G 4: 134,245,276 probably benign Het
Emc10 A C 7: 44,492,627 V124G probably damaging Het
Enam A T 5: 88,503,026 D723V probably benign Het
Eps8 C A 6: 137,527,130 Q158H probably damaging Het
Ercc6 G A 14: 32,541,296 D486N probably damaging Het
Fasn T C 11: 120,813,059 E1485G possibly damaging Het
Fat2 T C 11: 55,279,018 K2972E probably benign Het
Fbxw28 T C 9: 109,339,534 K30R probably null Het
Flot2 T A 11: 78,057,513 L164Q probably damaging Het
Fsip2 A T 2: 82,949,395 I162L probably benign Het
Fsip2 A T 2: 82,985,471 L3849F probably benign Het
Gabrb1 C G 5: 71,700,811 P60R probably damaging Het
Galnt14 T C 17: 73,504,898 R443G probably benign Het
Gas8 C T 8: 123,531,014 T400M probably benign Het
Gfap T C 11: 102,894,388 Y254C probably damaging Het
Git2 A G 5: 114,745,482 S396P probably damaging Het
Glb1l3 A T 9: 26,829,053 M327K probably benign Het
Gm10715 A C 9: 3,038,062 probably benign Het
Gm10787 G A 10: 77,022,007 noncoding transcript Het
Gm1123 T A 9: 99,018,569 D78V probably damaging Het
Gm27013 T C 6: 130,678,116 T128A probably benign Het
Gm8979 T C 7: 106,081,420 noncoding transcript Het
Gpbp1 A G 13: 111,440,630 probably null Het
Gphn G A 12: 78,522,955 probably null Het
Gpr157 A G 4: 150,102,366 E317G probably benign Het
Gsdmc4 T A 15: 63,893,747 M318L probably benign Het
Gtf2f2 A T 14: 76,010,691 W19R probably damaging Het
Helb A G 10: 120,084,858 V1060A probably benign Het
Igfn1 C T 1: 135,968,040 G1596D probably benign Het
Il1rl2 T C 1: 40,327,387 I27T possibly damaging Het
Inpp5j A G 11: 3,499,676 V702A probably damaging Het
Kmt2d A C 15: 98,861,894 V1161G unknown Het
Krtap1-3 T G 11: 99,590,889 Y144S possibly damaging Het
Layn C T 9: 51,057,382 V354M probably damaging Het
Lrba G A 3: 86,619,509 probably null Het
Lrp8 T A 4: 107,870,037 L893Q possibly damaging Het
Mrps9 T A 1: 42,898,415 probably benign Het
Mug1 T A 6: 121,885,854 M1387K probably damaging Het
Myo18b A C 5: 112,874,029 V499G probably benign Het
Nbea T C 3: 55,710,670 E2321G probably benign Het
Nrsn2 C T 2: 152,369,632 V160I probably benign Het
Nup210 G A 6: 91,031,668 Q510* probably null Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr693 T G 7: 106,678,123 D121A probably damaging Het
P3h3 G T 6: 124,850,637 Q479K possibly damaging Het
Paqr9 T A 9: 95,560,670 F238I probably damaging Het
Parp3 A T 9: 106,473,109 L343H probably damaging Het
Pcdh18 A C 3: 49,744,668 M1115R probably damaging Het
Pcdh8 A G 14: 79,770,868 V85A possibly damaging Het
Pcdhb4 A G 18: 37,308,399 N254S possibly damaging Het
Pld1 T C 3: 28,076,551 V500A probably benign Het
Prkg2 A T 5: 98,981,143 D311E probably benign Het
Prss42 T C 9: 110,799,301 L171P probably damaging Het
Pth2 T A 7: 45,181,343 L17H probably damaging Het
Reln A T 5: 22,018,846 probably null Het
Rmi2 G T 16: 10,839,837 V104L probably damaging Het
Rpusd4 T A 9: 35,268,535 V108D probably damaging Het
Rufy4 C A 1: 74,129,039 T82K possibly damaging Het
Scimp G A 11: 70,791,468 Q141* probably null Het
Sel1l2 T C 2: 140,263,470 T267A probably benign Het
Sema5a T A 15: 32,550,254 S146R possibly damaging Het
Sh2d3c T C 2: 32,721,160 M1T probably null Het
Slc30a6 T C 17: 74,405,721 L71P probably damaging Het
Srrm3 A G 5: 135,854,595 Y224C possibly damaging Het
Tacr3 A T 3: 134,854,854 T185S possibly damaging Het
Tas2r140 T A 6: 133,055,565 T77S probably benign Het
Thsd7b T C 1: 129,595,844 V128A probably benign Het
Tnfrsf10b T G 14: 69,776,159 H179Q probably damaging Het
Tonsl A G 15: 76,633,209 V770A probably benign Het
Trim42 G A 9: 97,362,929 P606L probably benign Het
Trim45 A T 3: 100,925,488 T346S possibly damaging Het
Ttc28 C A 5: 111,286,081 S2296Y probably damaging Het
Ttc41 C T 10: 86,731,125 R552C probably benign Het
Tube1 A G 10: 39,144,846 N243D probably benign Het
Tvp23b G T 11: 62,879,598 probably null Het
Ubxn11 T A 4: 134,109,608 I49N probably damaging Het
Usp17le T A 7: 104,769,770 E55V probably benign Het
Vmn2r114 A T 17: 23,291,379 V709D probably damaging Het
Vmn2r23 C T 6: 123,713,074 T303M probably damaging Het
Vmn2r60 C T 7: 42,135,861 P166S probably damaging Het
Vmn2r83 A G 10: 79,477,848 I97V possibly damaging Het
Vmn2r-ps159 G C 4: 156,333,438 noncoding transcript Het
Wbp2nl A T 15: 82,314,336 K358M possibly damaging Het
Xpo1 T A 11: 23,278,183 I150N probably damaging Het
Zfp113 G A 5: 138,145,425 L188F probably damaging Het
Zfp189 T G 4: 49,529,984 S362R probably damaging Het
Other mutations in Aspm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Aspm APN 1 139478691 missense probably damaging 1.00
IGL00594:Aspm APN 1 139487422 splice site probably benign
IGL00808:Aspm APN 1 139461476 missense probably benign 0.03
IGL00897:Aspm APN 1 139477407 missense probably damaging 0.98
IGL01024:Aspm APN 1 139478124 missense possibly damaging 0.66
IGL01410:Aspm APN 1 139482444 missense probably benign 0.25
IGL01588:Aspm APN 1 139478162 missense probably benign 0.11
IGL01610:Aspm APN 1 139489670 nonsense probably null
IGL01633:Aspm APN 1 139480836 missense possibly damaging 0.93
IGL01982:Aspm APN 1 139491588 missense probably benign 0.12
IGL02429:Aspm APN 1 139479810 missense probably benign 0.27
IGL02468:Aspm APN 1 139480950 missense probably damaging 1.00
IGL02519:Aspm APN 1 139461927 splice site probably benign
IGL02526:Aspm APN 1 139489719 missense probably benign 0.03
IGL02716:Aspm APN 1 139479687 missense probably damaging 1.00
IGL02876:Aspm APN 1 139473653 missense probably damaging 1.00
IGL02953:Aspm APN 1 139457419 missense probably benign 0.01
IGL03275:Aspm APN 1 139487295 missense probably damaging 1.00
3-1:Aspm UTSW 1 139457541 missense probably benign
R0016:Aspm UTSW 1 139479544 missense probably benign 0.01
R0016:Aspm UTSW 1 139479544 missense probably benign 0.01
R0106:Aspm UTSW 1 139476876 missense probably benign 0.02
R0106:Aspm UTSW 1 139476876 missense probably benign 0.02
R0140:Aspm UTSW 1 139480641 missense probably benign 0.00
R0195:Aspm UTSW 1 139479135 missense probably damaging 1.00
R0217:Aspm UTSW 1 139457880 missense possibly damaging 0.46
R0276:Aspm UTSW 1 139478471 missense possibly damaging 0.95
R0309:Aspm UTSW 1 139482511 splice site probably benign
R0466:Aspm UTSW 1 139477901 missense probably damaging 1.00
R0520:Aspm UTSW 1 139478820 missense possibly damaging 0.51
R0615:Aspm UTSW 1 139487289 missense probably damaging 1.00
R0626:Aspm UTSW 1 139491601 missense probably damaging 1.00
R0660:Aspm UTSW 1 139457764 missense probably benign 0.03
R0751:Aspm UTSW 1 139456898 splice site probably benign
R0830:Aspm UTSW 1 139474254 missense probably damaging 0.99
R1109:Aspm UTSW 1 139456758 missense probably damaging 0.99
R1114:Aspm UTSW 1 139461924 splice site probably benign
R1130:Aspm UTSW 1 139477834 missense possibly damaging 0.90
R1298:Aspm UTSW 1 139457419 missense probably benign 0.01
R1386:Aspm UTSW 1 139457623 missense probably benign 0.03
R1386:Aspm UTSW 1 139478972 missense possibly damaging 0.80
R1557:Aspm UTSW 1 139468668 missense probably benign 0.01
R1625:Aspm UTSW 1 139481039 missense probably benign 0.01
R1728:Aspm UTSW 1 139473574 missense probably benign
R1729:Aspm UTSW 1 139473574 missense probably benign
R1730:Aspm UTSW 1 139473574 missense probably benign
R1733:Aspm UTSW 1 139457117 missense probably benign 0.27
R1739:Aspm UTSW 1 139473574 missense probably benign
R1762:Aspm UTSW 1 139473574 missense probably benign
R1783:Aspm UTSW 1 139473574 missense probably benign
R1784:Aspm UTSW 1 139473574 missense probably benign
R1785:Aspm UTSW 1 139473574 missense probably benign
R1793:Aspm UTSW 1 139457341 missense probably benign 0.00
R1893:Aspm UTSW 1 139479867 missense probably damaging 1.00
R1911:Aspm UTSW 1 139478094 missense probably benign 0.06
R2103:Aspm UTSW 1 139491665 missense probably damaging 0.99
R2128:Aspm UTSW 1 139457635 missense probably benign 0.14
R2129:Aspm UTSW 1 139457635 missense probably benign 0.14
R2239:Aspm UTSW 1 139456846 missense possibly damaging 0.67
R2352:Aspm UTSW 1 139457562 missense probably benign 0.02
R2353:Aspm UTSW 1 139477697 missense probably damaging 1.00
R2380:Aspm UTSW 1 139479348 missense probably damaging 1.00
R2413:Aspm UTSW 1 139477757 missense probably damaging 1.00
R2421:Aspm UTSW 1 139488487 missense possibly damaging 0.49
R3607:Aspm UTSW 1 139480668 missense probably benign 0.13
R3711:Aspm UTSW 1 139458100 missense probably benign 0.17
R3718:Aspm UTSW 1 139480889 missense probably benign 0.09
R3718:Aspm UTSW 1 139490427 missense probably benign 0.31
R3741:Aspm UTSW 1 139478619 missense possibly damaging 0.47
R3788:Aspm UTSW 1 139463203 missense probably damaging 1.00
R3838:Aspm UTSW 1 139478054 missense probably benign 0.24
R3839:Aspm UTSW 1 139478054 missense probably benign 0.24
R3849:Aspm UTSW 1 139458286 missense probably benign 0.21
R4075:Aspm UTSW 1 139474285 missense probably damaging 1.00
R4080:Aspm UTSW 1 139470755 missense probably damaging 1.00
R4463:Aspm UTSW 1 139455010 missense possibly damaging 0.95
R4537:Aspm UTSW 1 139474303 missense probably benign 0.01
R4547:Aspm UTSW 1 139478187 missense possibly damaging 0.75
R4573:Aspm UTSW 1 139479507 missense probably damaging 0.98
R4680:Aspm UTSW 1 139480671 missense probably benign 0.05
R4807:Aspm UTSW 1 139477919 missense probably damaging 1.00
R4854:Aspm UTSW 1 139478072 nonsense probably null
R4859:Aspm UTSW 1 139469393 missense probably damaging 1.00
R4893:Aspm UTSW 1 139489839 critical splice donor site probably null
R4910:Aspm UTSW 1 139491543 missense probably damaging 1.00
R4953:Aspm UTSW 1 139471734 missense probably benign 0.00
R4974:Aspm UTSW 1 139478010 missense probably benign 0.03
R4981:Aspm UTSW 1 139470760 splice site probably null
R5082:Aspm UTSW 1 139478676 nonsense probably null
R5223:Aspm UTSW 1 139478334 missense probably damaging 1.00
R5268:Aspm UTSW 1 139464295 missense probably damaging 1.00
R5371:Aspm UTSW 1 139470541 nonsense probably null
R5377:Aspm UTSW 1 139457483 missense probably damaging 0.96
R5377:Aspm UTSW 1 139470395 intron probably null
R5481:Aspm UTSW 1 139457061 missense possibly damaging 0.85
R5513:Aspm UTSW 1 139482398 missense probably damaging 1.00
R5578:Aspm UTSW 1 139470717 missense probably damaging 1.00
R5649:Aspm UTSW 1 139479669 missense probably benign
R5685:Aspm UTSW 1 139487288 missense probably benign 0.10
R5695:Aspm UTSW 1 139479669 missense probably benign
R5766:Aspm UTSW 1 139479002 missense probably damaging 0.99
R5964:Aspm UTSW 1 139455227 intron probably benign
R5993:Aspm UTSW 1 139479531 missense probably benign 0.28
R6027:Aspm UTSW 1 139463056 missense probably damaging 1.00
R6029:Aspm UTSW 1 139480990 missense possibly damaging 0.83
R6102:Aspm UTSW 1 139477459 nonsense probably null
R6188:Aspm UTSW 1 139479239 missense possibly damaging 0.79
R6257:Aspm UTSW 1 139482053 intron probably null
R6433:Aspm UTSW 1 139473683 missense probably damaging 1.00
R6682:Aspm UTSW 1 139457722 missense possibly damaging 0.67
R6763:Aspm UTSW 1 139470517 missense possibly damaging 0.64
R6798:Aspm UTSW 1 139468685 missense possibly damaging 0.66
R6815:Aspm UTSW 1 139480142 missense probably benign 0.04
R6854:Aspm UTSW 1 139463182 missense possibly damaging 0.90
R6928:Aspm UTSW 1 139480206 nonsense probably null
R6943:Aspm UTSW 1 139480542 missense probably damaging 1.00
R6979:Aspm UTSW 1 139480485 missense probably damaging 1.00
R6998:Aspm UTSW 1 139469472 missense probably damaging 1.00
R7126:Aspm UTSW 1 139480803 missense probably benign 0.27
R7237:Aspm UTSW 1 139477929 missense possibly damaging 0.81
R7240:Aspm UTSW 1 139478651 nonsense probably null
R7272:Aspm UTSW 1 139458328 missense probably benign 0.14
X0063:Aspm UTSW 1 139458090 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTTGGATAGTTTCTGGGAGACC -3'
(R):5'- TGTGCCTGTCCACAACATCC -3'

Sequencing Primer
(F):5'- GGAGACCTTTTGTCCTTAATGTG -3'
(R):5'- TCCTTAGACGAGATAGCGCTC -3'
Posted On2016-03-01