Incidental Mutation 'R4840:Ttc28'
ID371715
Institutional Source Beutler Lab
Gene Symbol Ttc28
Ensembl Gene ENSMUSG00000033209
Gene Nametetratricopeptide repeat domain 28
Synonyms
MMRRC Submission 042453-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.602) question?
Stock #R4840 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location110879803-111289780 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 111286081 bp
ZygosityHeterozygous
Amino Acid Change Serine to Tyrosine at position 2296 (S2296Y)
Ref Sequence ENSEMBL: ENSMUSP00000137609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040111] [ENSMUST00000156290]
Predicted Effect probably damaging
Transcript: ENSMUST00000040111
AA Change: S2327Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136116
Gene: ENSMUSG00000033209
AA Change: S2327Y

DomainStartEndE-ValueType
low complexity region 4 28 N/A INTRINSIC
TPR 52 85 2.84e1 SMART
TPR 86 119 5.03e-1 SMART
TPR 120 153 2.11e-3 SMART
TPR 268 301 8.51e0 SMART
TPR 339 372 1.78e-1 SMART
TPR 379 412 2.82e-4 SMART
TPR 419 452 9.98e-5 SMART
TPR 459 492 1.88e0 SMART
TPR 499 532 1.11e1 SMART
TPR 539 572 2.93e-2 SMART
TPR 579 612 1.21e-3 SMART
TPR 619 652 4.91e-4 SMART
TPR 659 692 7.56e-5 SMART
TPR 699 732 8.29e0 SMART
TPR 739 772 1.63e0 SMART
TPR 779 812 1.24e0 SMART
TPR 819 852 7.98e-4 SMART
TPR 859 892 8.74e0 SMART
TPR 902 935 5.43e-6 SMART
TPR 942 975 4.09e-1 SMART
TPR 982 1015 9.98e-5 SMART
TPR 1022 1055 7.12e-1 SMART
TPR 1062 1095 5.69e0 SMART
TPR 1102 1135 3.14e-2 SMART
TPR 1142 1175 2.84e1 SMART
low complexity region 1259 1277 N/A INTRINSIC
Pfam:CHAT 1415 1738 7.3e-77 PFAM
low complexity region 1972 1990 N/A INTRINSIC
low complexity region 2014 2031 N/A INTRINSIC
low complexity region 2033 2045 N/A INTRINSIC
low complexity region 2155 2171 N/A INTRINSIC
low complexity region 2283 2293 N/A INTRINSIC
low complexity region 2327 2352 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000156290
AA Change: S2296Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137609
Gene: ENSMUSG00000033209
AA Change: S2296Y

DomainStartEndE-ValueType
low complexity region 4 28 N/A INTRINSIC
TPR 52 85 2.84e1 SMART
TPR 86 119 5.03e-1 SMART
TPR 120 153 2.11e-3 SMART
TPR 268 301 8.51e0 SMART
TPR 308 341 1.78e-1 SMART
TPR 348 381 2.82e-4 SMART
TPR 388 421 9.98e-5 SMART
TPR 428 461 1.88e0 SMART
TPR 468 501 1.11e1 SMART
TPR 508 541 2.93e-2 SMART
TPR 548 581 1.21e-3 SMART
TPR 588 621 4.91e-4 SMART
TPR 628 661 7.56e-5 SMART
TPR 668 701 8.29e0 SMART
TPR 708 741 1.63e0 SMART
TPR 748 781 1.24e0 SMART
TPR 788 821 7.98e-4 SMART
TPR 828 861 8.74e0 SMART
TPR 871 904 5.43e-6 SMART
TPR 911 944 4.09e-1 SMART
TPR 951 984 9.98e-5 SMART
TPR 991 1024 7.12e-1 SMART
TPR 1031 1064 5.69e0 SMART
TPR 1071 1104 3.14e-2 SMART
TPR 1111 1144 2.84e1 SMART
low complexity region 1228 1246 N/A INTRINSIC
Pfam:CHAT 1384 1707 1.1e-76 PFAM
low complexity region 1941 1959 N/A INTRINSIC
low complexity region 1983 2000 N/A INTRINSIC
low complexity region 2002 2014 N/A INTRINSIC
low complexity region 2124 2140 N/A INTRINSIC
low complexity region 2252 2262 N/A INTRINSIC
low complexity region 2296 2321 N/A INTRINSIC
Meta Mutation Damage Score 0.226 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 97% (114/117)
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik C A 1: 86,046,444 T161K probably benign Het
Actn3 G A 19: 4,864,511 R530W probably damaging Het
Alg11 C T 8: 22,068,010 A404V possibly damaging Het
Alkbh8 T A 9: 3,369,751 V340D probably damaging Het
Arhgef12 T C 9: 42,975,068 H1166R probably benign Het
Aspm T A 1: 139,470,531 D978E possibly damaging Het
Bod1l C T 5: 41,818,472 G1833D probably damaging Het
Brd3 A G 2: 27,449,239 V676A possibly damaging Het
Brip1 G A 11: 86,146,183 T454I possibly damaging Het
C3ar1 T C 6: 122,850,764 I165V probably benign Het
C87977 T C 4: 144,208,574 K199R probably damaging Het
Camta1 T A 4: 151,144,407 Q656L probably benign Het
Casp14 A T 10: 78,713,344 L256* probably null Het
Cdh23 G T 10: 60,419,777 H773Q possibly damaging Het
Chd1 G A 17: 15,768,753 W1589* probably null Het
Chd1 G T 17: 15,768,754 D1590Y probably damaging Het
Cldn19 A G 4: 119,255,754 Q61R probably damaging Het
Cyp2a22 A G 7: 26,932,524 S436P probably benign Het
E130218I03Rik A G 4: 134,245,276 probably benign Het
Emc10 A C 7: 44,492,627 V124G probably damaging Het
Enam A T 5: 88,503,026 D723V probably benign Het
Eps8 C A 6: 137,527,130 Q158H probably damaging Het
Ercc6 G A 14: 32,541,296 D486N probably damaging Het
Fasn T C 11: 120,813,059 E1485G possibly damaging Het
Fat2 T C 11: 55,279,018 K2972E probably benign Het
Fbxw28 T C 9: 109,339,534 K30R probably null Het
Flot2 T A 11: 78,057,513 L164Q probably damaging Het
Fsip2 A T 2: 82,949,395 I162L probably benign Het
Fsip2 A T 2: 82,985,471 L3849F probably benign Het
Gabrb1 C G 5: 71,700,811 P60R probably damaging Het
Galnt14 T C 17: 73,504,898 R443G probably benign Het
Gas8 C T 8: 123,531,014 T400M probably benign Het
Gfap T C 11: 102,894,388 Y254C probably damaging Het
Git2 A G 5: 114,745,482 S396P probably damaging Het
Glb1l3 A T 9: 26,829,053 M327K probably benign Het
Gm10715 A C 9: 3,038,062 probably benign Het
Gm10787 G A 10: 77,022,007 noncoding transcript Het
Gm1123 T A 9: 99,018,569 D78V probably damaging Het
Gm27013 T C 6: 130,678,116 T128A probably benign Het
Gm8979 T C 7: 106,081,420 noncoding transcript Het
Gpbp1 A G 13: 111,440,630 probably null Het
Gphn G A 12: 78,522,955 probably null Het
Gpr157 A G 4: 150,102,366 E317G probably benign Het
Gsdmc4 T A 15: 63,893,747 M318L probably benign Het
Gtf2f2 A T 14: 76,010,691 W19R probably damaging Het
Helb A G 10: 120,084,858 V1060A probably benign Het
Igfn1 C T 1: 135,968,040 G1596D probably benign Het
Il1rl2 T C 1: 40,327,387 I27T possibly damaging Het
Inpp5j A G 11: 3,499,676 V702A probably damaging Het
Kmt2d A C 15: 98,861,894 V1161G unknown Het
Krtap1-3 T G 11: 99,590,889 Y144S possibly damaging Het
Layn C T 9: 51,057,382 V354M probably damaging Het
Lrba G A 3: 86,619,509 probably null Het
Lrp8 T A 4: 107,870,037 L893Q possibly damaging Het
Mrps9 T A 1: 42,898,415 probably benign Het
Mug1 T A 6: 121,885,854 M1387K probably damaging Het
Myo18b A C 5: 112,874,029 V499G probably benign Het
Nbea T C 3: 55,710,670 E2321G probably benign Het
Nrsn2 C T 2: 152,369,632 V160I probably benign Het
Nup210 G A 6: 91,031,668 Q510* probably null Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr693 T G 7: 106,678,123 D121A probably damaging Het
P3h3 G T 6: 124,850,637 Q479K possibly damaging Het
Paqr9 T A 9: 95,560,670 F238I probably damaging Het
Parp3 A T 9: 106,473,109 L343H probably damaging Het
Pcdh18 A C 3: 49,744,668 M1115R probably damaging Het
Pcdh8 A G 14: 79,770,868 V85A possibly damaging Het
Pcdhb4 A G 18: 37,308,399 N254S possibly damaging Het
Pld1 T C 3: 28,076,551 V500A probably benign Het
Prkg2 A T 5: 98,981,143 D311E probably benign Het
Prss42 T C 9: 110,799,301 L171P probably damaging Het
Pth2 T A 7: 45,181,343 L17H probably damaging Het
Reln A T 5: 22,018,846 probably null Het
Rmi2 G T 16: 10,839,837 V104L probably damaging Het
Rpusd4 T A 9: 35,268,535 V108D probably damaging Het
Rufy4 C A 1: 74,129,039 T82K possibly damaging Het
Scimp G A 11: 70,791,468 Q141* probably null Het
Sel1l2 T C 2: 140,263,470 T267A probably benign Het
Sema5a T A 15: 32,550,254 S146R possibly damaging Het
Sh2d3c T C 2: 32,721,160 M1T probably null Het
Slc30a6 T C 17: 74,405,721 L71P probably damaging Het
Srrm3 A G 5: 135,854,595 Y224C possibly damaging Het
Tacr3 A T 3: 134,854,854 T185S possibly damaging Het
Tas2r140 T A 6: 133,055,565 T77S probably benign Het
Thsd7b T C 1: 129,595,844 V128A probably benign Het
Tnfrsf10b T G 14: 69,776,159 H179Q probably damaging Het
Tonsl A G 15: 76,633,209 V770A probably benign Het
Trim42 G A 9: 97,362,929 P606L probably benign Het
Trim45 A T 3: 100,925,488 T346S possibly damaging Het
Ttc41 C T 10: 86,731,125 R552C probably benign Het
Tube1 A G 10: 39,144,846 N243D probably benign Het
Tvp23b G T 11: 62,879,598 probably null Het
Ubxn11 T A 4: 134,109,608 I49N probably damaging Het
Usp17le T A 7: 104,769,770 E55V probably benign Het
Vmn2r114 A T 17: 23,291,379 V709D probably damaging Het
Vmn2r23 C T 6: 123,713,074 T303M probably damaging Het
Vmn2r60 C T 7: 42,135,861 P166S probably damaging Het
Vmn2r83 A G 10: 79,477,848 I97V possibly damaging Het
Vmn2r-ps159 G C 4: 156,333,438 noncoding transcript Het
Wbp2nl A T 15: 82,314,336 K358M possibly damaging Het
Xpo1 T A 11: 23,278,183 I150N probably damaging Het
Zfp113 G A 5: 138,145,425 L188F probably damaging Het
Zfp189 T G 4: 49,529,984 S362R probably damaging Het
Other mutations in Ttc28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Ttc28 APN 5 111225688 missense probably damaging 1.00
IGL00963:Ttc28 APN 5 111286389 nonsense probably null
IGL00969:Ttc28 APN 5 111225740 missense probably benign 0.00
IGL01366:Ttc28 APN 5 111085171 critical splice donor site probably null
IGL01528:Ttc28 APN 5 111101960 splice site probably benign
IGL01558:Ttc28 APN 5 111283962 missense probably damaging 0.99
IGL01973:Ttc28 APN 5 111224235 missense possibly damaging 0.88
IGL02040:Ttc28 APN 5 110892936 nonsense probably null
IGL02432:Ttc28 APN 5 111223235 missense probably damaging 1.00
IGL02531:Ttc28 APN 5 111225850 missense probably damaging 1.00
IGL02819:Ttc28 APN 5 111266583 missense probably benign
IGL02830:Ttc28 APN 5 111286239 missense probably benign 0.10
IGL02893:Ttc28 APN 5 111285385 missense possibly damaging 0.87
IGL03387:Ttc28 APN 5 111233342 missense probably benign 0.07
PIT4131001:Ttc28 UTSW 5 110892853 missense probably benign 0.00
R0142:Ttc28 UTSW 5 111277457 missense probably benign 0.40
R0166:Ttc28 UTSW 5 111225634 missense probably benign 0.01
R0328:Ttc28 UTSW 5 111284067 splice site probably benign
R0582:Ttc28 UTSW 5 111183296 missense probably damaging 1.00
R0744:Ttc28 UTSW 5 111231081 missense probably damaging 1.00
R0811:Ttc28 UTSW 5 111235500 missense probably benign 0.24
R0812:Ttc28 UTSW 5 111235500 missense probably benign 0.24
R0828:Ttc28 UTSW 5 111223446 missense probably damaging 1.00
R0833:Ttc28 UTSW 5 111231081 missense probably damaging 1.00
R1013:Ttc28 UTSW 5 111276965 missense probably benign 0.01
R1168:Ttc28 UTSW 5 111231111 missense probably damaging 1.00
R1194:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1195:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1195:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1195:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1196:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1205:Ttc28 UTSW 5 111285769 missense probably benign 0.04
R1386:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1467:Ttc28 UTSW 5 111285388 missense probably benign 0.00
R1467:Ttc28 UTSW 5 111285388 missense probably benign 0.00
R1537:Ttc28 UTSW 5 111285318 missense probably damaging 0.96
R1539:Ttc28 UTSW 5 111100811 missense possibly damaging 0.77
R1558:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1560:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1561:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1566:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1768:Ttc28 UTSW 5 111277168 missense possibly damaging 0.77
R1775:Ttc28 UTSW 5 111276811 missense probably benign 0.00
R1909:Ttc28 UTSW 5 111284054 critical splice donor site probably null
R1911:Ttc28 UTSW 5 111280750 missense possibly damaging 0.93
R1970:Ttc28 UTSW 5 111235635 missense probably benign 0.00
R1990:Ttc28 UTSW 5 111276322 missense probably benign 0.37
R1992:Ttc28 UTSW 5 111276322 missense probably benign 0.37
R2066:Ttc28 UTSW 5 111225933 missense probably benign 0.01
R2112:Ttc28 UTSW 5 111276273 missense probably damaging 0.99
R2158:Ttc28 UTSW 5 111177617 intron probably benign
R2192:Ttc28 UTSW 5 111223496 missense probably damaging 0.99
R2267:Ttc28 UTSW 5 111226003 missense possibly damaging 0.75
R2384:Ttc28 UTSW 5 111276208 missense possibly damaging 0.95
R2989:Ttc28 UTSW 5 111224015 missense probably benign 0.29
R3881:Ttc28 UTSW 5 111183240 missense probably damaging 1.00
R3919:Ttc28 UTSW 5 111285379 missense possibly damaging 0.80
R4455:Ttc28 UTSW 5 111224058 frame shift probably null
R4456:Ttc28 UTSW 5 111224058 frame shift probably null
R4522:Ttc28 UTSW 5 111280172 missense probably benign 0.01
R4548:Ttc28 UTSW 5 111271224 missense possibly damaging 0.86
R4591:Ttc28 UTSW 5 111223281 missense probably damaging 1.00
R4633:Ttc28 UTSW 5 111224001 missense probably damaging 1.00
R4700:Ttc28 UTSW 5 111277043 missense probably damaging 1.00
R4714:Ttc28 UTSW 5 111285229 missense possibly damaging 0.65
R4790:Ttc28 UTSW 5 111224217 missense possibly damaging 0.94
R4803:Ttc28 UTSW 5 111277463 missense possibly damaging 0.90
R4969:Ttc28 UTSW 5 111276255 missense probably damaging 0.96
R5019:Ttc28 UTSW 5 111102064 missense possibly damaging 0.47
R5130:Ttc28 UTSW 5 110892856 missense probably benign
R5150:Ttc28 UTSW 5 111225689 missense probably damaging 1.00
R5214:Ttc28 UTSW 5 111177623 intron probably benign
R5254:Ttc28 UTSW 5 111271238 missense probably benign 0.01
R5518:Ttc28 UTSW 5 111225928 missense probably benign 0.17
R5851:Ttc28 UTSW 5 111235469 splice site probably benign
R5931:Ttc28 UTSW 5 111085109 missense possibly damaging 0.81
R6011:Ttc28 UTSW 5 111286443 missense probably benign
R6176:Ttc28 UTSW 5 111223985 missense probably damaging 1.00
R6221:Ttc28 UTSW 5 111271248 missense probably benign 0.00
R6398:Ttc28 UTSW 5 111276276 missense probably damaging 1.00
R6717:Ttc28 UTSW 5 111285436 missense probably benign
R6770:Ttc28 UTSW 5 111286140 missense probably damaging 1.00
R6901:Ttc28 UTSW 5 111277025 missense possibly damaging 0.88
R7038:Ttc28 UTSW 5 111266579 missense probably benign 0.09
R7073:Ttc28 UTSW 5 111223416 missense possibly damaging 0.96
R7101:Ttc28 UTSW 5 111085092 missense probably damaging 1.00
R7135:Ttc28 UTSW 5 111280007 missense probably damaging 1.00
V8831:Ttc28 UTSW 5 111100712 missense probably benign 0.11
Z1088:Ttc28 UTSW 5 111286315 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTCGCCACTCACTGTCAAAC -3'
(R):5'- ACCTCGACATGTTTTCCGG -3'

Sequencing Primer
(F):5'- ATCTCTTCCCAAGGTGAGCAG -3'
(R):5'- ACATGTTTTCCGGGGGCC -3'
Posted On2016-03-01