Incidental Mutation 'R4840:Chd1'
ID371780
Institutional Source Beutler Lab
Gene Symbol Chd1
Ensembl Gene ENSMUSG00000023852
Gene Namechromodomain helicase DNA binding protein 1
Synonyms4930525N21Rik
MMRRC Submission 042453-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4840 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location15704967-15772610 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 15768754 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 1590 (D1590Y)
Ref Sequence ENSEMBL: ENSMUSP00000024627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024627]
Predicted Effect probably damaging
Transcript: ENSMUST00000024627
AA Change: D1590Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024627
Gene: ENSMUSG00000023852
AA Change: D1590Y

DomainStartEndE-ValueType
low complexity region 17 67 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 116 136 N/A INTRINSIC
low complexity region 151 175 N/A INTRINSIC
low complexity region 213 230 N/A INTRINSIC
CHROMO 268 355 6.43e-20 SMART
CHROMO 385 443 1.19e-14 SMART
DEXDc 475 672 3.44e-34 SMART
Blast:DEXDc 692 786 2e-54 BLAST
low complexity region 787 799 N/A INTRINSIC
HELICc 816 900 8.48e-25 SMART
Blast:DEXDc 955 1234 1e-112 BLAST
PDB:4B4C|A 1119 1320 1e-132 PDB
low complexity region 1325 1348 N/A INTRINSIC
low complexity region 1377 1388 N/A INTRINSIC
DUF4208 1396 1500 5.54e-51 SMART
low complexity region 1507 1516 N/A INTRINSIC
low complexity region 1538 1549 N/A INTRINSIC
low complexity region 1626 1650 N/A INTRINSIC
Meta Mutation Damage Score 0.378 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 97% (114/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with arrest of epiblast development due to increased apoptosis and cell cycle defects, abnormal rostral-caudal axis patterning, and failure to gastrulate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik C A 1: 86,046,444 T161K probably benign Het
Actn3 G A 19: 4,864,511 R530W probably damaging Het
Alg11 C T 8: 22,068,010 A404V possibly damaging Het
Alkbh8 T A 9: 3,369,751 V340D probably damaging Het
Arhgef12 T C 9: 42,975,068 H1166R probably benign Het
Aspm T A 1: 139,470,531 D978E possibly damaging Het
Bod1l C T 5: 41,818,472 G1833D probably damaging Het
Brd3 A G 2: 27,449,239 V676A possibly damaging Het
Brip1 G A 11: 86,146,183 T454I possibly damaging Het
C3ar1 T C 6: 122,850,764 I165V probably benign Het
C87977 T C 4: 144,208,574 K199R probably damaging Het
Camta1 T A 4: 151,144,407 Q656L probably benign Het
Casp14 A T 10: 78,713,344 L256* probably null Het
Cdh23 G T 10: 60,419,777 H773Q possibly damaging Het
Cldn19 A G 4: 119,255,754 Q61R probably damaging Het
Cyp2a22 A G 7: 26,932,524 S436P probably benign Het
E130218I03Rik A G 4: 134,245,276 probably benign Het
Emc10 A C 7: 44,492,627 V124G probably damaging Het
Enam A T 5: 88,503,026 D723V probably benign Het
Eps8 C A 6: 137,527,130 Q158H probably damaging Het
Ercc6 G A 14: 32,541,296 D486N probably damaging Het
Fasn T C 11: 120,813,059 E1485G possibly damaging Het
Fat2 T C 11: 55,279,018 K2972E probably benign Het
Fbxw28 T C 9: 109,339,534 K30R probably null Het
Flot2 T A 11: 78,057,513 L164Q probably damaging Het
Fsip2 A T 2: 82,949,395 I162L probably benign Het
Fsip2 A T 2: 82,985,471 L3849F probably benign Het
Gabrb1 C G 5: 71,700,811 P60R probably damaging Het
Galnt14 T C 17: 73,504,898 R443G probably benign Het
Gas8 C T 8: 123,531,014 T400M probably benign Het
Gfap T C 11: 102,894,388 Y254C probably damaging Het
Git2 A G 5: 114,745,482 S396P probably damaging Het
Glb1l3 A T 9: 26,829,053 M327K probably benign Het
Gm10715 A C 9: 3,038,062 probably benign Het
Gm10787 G A 10: 77,022,007 noncoding transcript Het
Gm1123 T A 9: 99,018,569 D78V probably damaging Het
Gm27013 T C 6: 130,678,116 T128A probably benign Het
Gm8979 T C 7: 106,081,420 noncoding transcript Het
Gpbp1 A G 13: 111,440,630 probably null Het
Gphn G A 12: 78,522,955 probably null Het
Gpr157 A G 4: 150,102,366 E317G probably benign Het
Gsdmc4 T A 15: 63,893,747 M318L probably benign Het
Gtf2f2 A T 14: 76,010,691 W19R probably damaging Het
Helb A G 10: 120,084,858 V1060A probably benign Het
Igfn1 C T 1: 135,968,040 G1596D probably benign Het
Il1rl2 T C 1: 40,327,387 I27T possibly damaging Het
Inpp5j A G 11: 3,499,676 V702A probably damaging Het
Kmt2d A C 15: 98,861,894 V1161G unknown Het
Krtap1-3 T G 11: 99,590,889 Y144S possibly damaging Het
Layn C T 9: 51,057,382 V354M probably damaging Het
Lrba G A 3: 86,619,509 probably null Het
Lrp8 T A 4: 107,870,037 L893Q possibly damaging Het
Mrps9 T A 1: 42,898,415 probably benign Het
Mug1 T A 6: 121,885,854 M1387K probably damaging Het
Myo18b A C 5: 112,874,029 V499G probably benign Het
Nbea T C 3: 55,710,670 E2321G probably benign Het
Nrsn2 C T 2: 152,369,632 V160I probably benign Het
Nup210 G A 6: 91,031,668 Q510* probably null Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr693 T G 7: 106,678,123 D121A probably damaging Het
P3h3 G T 6: 124,850,637 Q479K possibly damaging Het
Paqr9 T A 9: 95,560,670 F238I probably damaging Het
Parp3 A T 9: 106,473,109 L343H probably damaging Het
Pcdh18 A C 3: 49,744,668 M1115R probably damaging Het
Pcdh8 A G 14: 79,770,868 V85A possibly damaging Het
Pcdhb4 A G 18: 37,308,399 N254S possibly damaging Het
Pld1 T C 3: 28,076,551 V500A probably benign Het
Prkg2 A T 5: 98,981,143 D311E probably benign Het
Prss42 T C 9: 110,799,301 L171P probably damaging Het
Pth2 T A 7: 45,181,343 L17H probably damaging Het
Reln A T 5: 22,018,846 probably null Het
Rmi2 G T 16: 10,839,837 V104L probably damaging Het
Rpusd4 T A 9: 35,268,535 V108D probably damaging Het
Rufy4 C A 1: 74,129,039 T82K possibly damaging Het
Scimp G A 11: 70,791,468 Q141* probably null Het
Sel1l2 T C 2: 140,263,470 T267A probably benign Het
Sema5a T A 15: 32,550,254 S146R possibly damaging Het
Sh2d3c T C 2: 32,721,160 M1T probably null Het
Slc30a6 T C 17: 74,405,721 L71P probably damaging Het
Srrm3 A G 5: 135,854,595 Y224C possibly damaging Het
Tacr3 A T 3: 134,854,854 T185S possibly damaging Het
Tas2r140 T A 6: 133,055,565 T77S probably benign Het
Thsd7b T C 1: 129,595,844 V128A probably benign Het
Tnfrsf10b T G 14: 69,776,159 H179Q probably damaging Het
Tonsl A G 15: 76,633,209 V770A probably benign Het
Trim42 G A 9: 97,362,929 P606L probably benign Het
Trim45 A T 3: 100,925,488 T346S possibly damaging Het
Ttc28 C A 5: 111,286,081 S2296Y probably damaging Het
Ttc41 C T 10: 86,731,125 R552C probably benign Het
Tube1 A G 10: 39,144,846 N243D probably benign Het
Tvp23b G T 11: 62,879,598 probably null Het
Ubxn11 T A 4: 134,109,608 I49N probably damaging Het
Usp17le T A 7: 104,769,770 E55V probably benign Het
Vmn2r114 A T 17: 23,291,379 V709D probably damaging Het
Vmn2r23 C T 6: 123,713,074 T303M probably damaging Het
Vmn2r60 C T 7: 42,135,861 P166S probably damaging Het
Vmn2r83 A G 10: 79,477,848 I97V possibly damaging Het
Vmn2r-ps159 G C 4: 156,333,438 noncoding transcript Het
Wbp2nl A T 15: 82,314,336 K358M possibly damaging Het
Xpo1 T A 11: 23,278,183 I150N probably damaging Het
Zfp113 G A 5: 138,145,425 L188F probably damaging Het
Zfp189 T G 4: 49,529,984 S362R probably damaging Het
Other mutations in Chd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Chd1 APN 17 15732565 missense probably benign 0.37
IGL01356:Chd1 APN 17 15749865 missense probably damaging 1.00
IGL01369:Chd1 APN 17 15754997 missense probably damaging 0.97
IGL01519:Chd1 APN 17 17378569 missense probably damaging 1.00
IGL01604:Chd1 APN 17 15770097 missense possibly damaging 0.95
IGL01635:Chd1 APN 17 17378596 missense probably damaging 1.00
IGL01721:Chd1 APN 17 15770168 missense probably damaging 1.00
IGL01959:Chd1 APN 17 15742173 missense probably damaging 1.00
IGL02367:Chd1 APN 17 17390053 missense probably damaging 0.98
IGL02476:Chd1 APN 17 15734273 missense probably damaging 1.00
IGL02756:Chd1 APN 17 15730807 missense probably damaging 0.97
IGL02817:Chd1 APN 17 15749500 missense possibly damaging 0.92
IGL03084:Chd1 APN 17 15770298 missense probably benign 0.22
IGL03108:Chd1 APN 17 15725281 missense possibly damaging 0.70
holly UTSW 17 15726283 missense possibly damaging 0.72
R0053:Chd1 UTSW 17 15747189 missense probably damaging 1.00
R0053:Chd1 UTSW 17 15747189 missense probably damaging 1.00
R0128:Chd1 UTSW 17 17393567 missense probably damaging 1.00
R0197:Chd1 UTSW 17 15725431 missense probably benign
R0285:Chd1 UTSW 17 17374680 splice site probably benign
R0326:Chd1 UTSW 17 15768566 missense probably damaging 1.00
R0326:Chd1 UTSW 17 15768568 missense probably benign
R0372:Chd1 UTSW 17 17387290 missense probably benign 0.14
R0391:Chd1 UTSW 17 15749894 missense probably damaging 1.00
R0486:Chd1 UTSW 17 15734342 missense probably damaging 0.99
R0637:Chd1 UTSW 17 15742288 missense possibly damaging 0.50
R0675:Chd1 UTSW 17 15758261 unclassified probably benign
R0701:Chd1 UTSW 17 15725431 missense probably benign
R0788:Chd1 UTSW 17 15707114 missense possibly damaging 0.86
R0848:Chd1 UTSW 17 15770241 missense probably damaging 1.00
R0883:Chd1 UTSW 17 15725431 missense probably benign
R1169:Chd1 UTSW 17 15735732 missense probably damaging 1.00
R1218:Chd1 UTSW 17 15725312 missense probably damaging 1.00
R1370:Chd1 UTSW 17 17387480 missense probably benign 0.00
R1470:Chd1 UTSW 17 15726283 missense possibly damaging 0.72
R1470:Chd1 UTSW 17 15726283 missense possibly damaging 0.72
R1478:Chd1 UTSW 17 15739507 missense probably damaging 0.99
R1752:Chd1 UTSW 17 15743232 critical splice donor site probably null
R1759:Chd1 UTSW 17 17387271 missense probably benign 0.00
R1767:Chd1 UTSW 17 15770303 missense probably damaging 1.00
R1938:Chd1 UTSW 17 15762486 missense probably benign 0.39
R2007:Chd1 UTSW 17 15731006 missense probably damaging 1.00
R2069:Chd1 UTSW 17 15742294 missense probably damaging 1.00
R3771:Chd1 UTSW 17 17374651 missense probably damaging 1.00
R3773:Chd1 UTSW 17 17374651 missense probably damaging 1.00
R3849:Chd1 UTSW 17 15731871 missense probably damaging 1.00
R4241:Chd1 UTSW 17 15770027 nonsense probably null
R4242:Chd1 UTSW 17 15770027 nonsense probably null
R4354:Chd1 UTSW 17 17390001 missense probably benign 0.23
R4468:Chd1 UTSW 17 15760395 missense probably damaging 0.99
R4469:Chd1 UTSW 17 15760395 missense probably damaging 0.99
R4731:Chd1 UTSW 17 17377817 missense probably benign 0.36
R4824:Chd1 UTSW 17 15733124 missense probably damaging 1.00
R4840:Chd1 UTSW 17 15768753 nonsense probably null
R4880:Chd1 UTSW 17 17374654 missense probably damaging 1.00
R4960:Chd1 UTSW 17 15742231 missense probably damaging 0.96
R5071:Chd1 UTSW 17 15762405 missense probably benign
R5078:Chd1 UTSW 17 15726354 missense possibly damaging 0.93
R5114:Chd1 UTSW 17 15728198 missense probably benign 0.25
R5268:Chd1 UTSW 17 15735743 missense probably damaging 1.00
R5304:Chd1 UTSW 17 15754951 missense probably benign 0.01
R5304:Chd1 UTSW 17 15770268 missense possibly damaging 0.55
R5307:Chd1 UTSW 17 15732570 missense probably damaging 1.00
R5458:Chd1 UTSW 17 15738549 missense probably damaging 1.00
R5553:Chd1 UTSW 17 17385613 missense probably benign 0.17
R5623:Chd1 UTSW 17 15754932 missense probably damaging 1.00
R6022:Chd1 UTSW 17 17377773 missense probably benign 0.39
R6137:Chd1 UTSW 17 15758688 missense probably damaging 1.00
R6257:Chd1 UTSW 17 15730203 intron probably null
R6373:Chd1 UTSW 17 15738636 missense probably damaging 1.00
R6458:Chd1 UTSW 17 15730602 missense probably benign 0.01
R6476:Chd1 UTSW 17 17380988 critical splice donor site probably null
R6508:Chd1 UTSW 17 15738633 missense probably benign 0.31
R6553:Chd1 UTSW 17 15725430 missense probably benign 0.00
R6745:Chd1 UTSW 17 17387167 missense probably benign 0.08
R7107:Chd1 UTSW 17 15761366 missense probably damaging 0.98
R7230:Chd1 UTSW 17 15706937 splice site probably null
R7317:Chd1 UTSW 17 15742274 missense possibly damaging 0.71
R7341:Chd1 UTSW 17 15770237 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGGCAGGAGTTACTGTTATTAT -3'
(R):5'- TTCCACCAACAAGCTGCACT -3'

Sequencing Primer
(F):5'- GTAGCAGGGACAGCTATT -3'
(R):5'- CCAACAAGCTGCACTATTTAAAATG -3'
Posted On2016-03-01