Incidental Mutation 'R4841:Pde4dip'
ID371805
Institutional Source Beutler Lab
Gene Symbol Pde4dip
Ensembl Gene ENSMUSG00000038170
Gene Namephosphodiesterase 4D interacting protein (myomegalin)
SynonymsD130016K21Rik, Usmg4, 4732458A06Rik, D3Bwg1078e, 9430063L05Rik
MMRRC Submission 042454-MU
Accession Numbers

Genbank:NM_001039376.2, NM_001110163.1, NM_178080.4, NM_177145.3; MGI: 1891434; Ensembl: ENSMUST00000045243, ENSMUST00000090750, ENSMUST00000107038, ENSMUST00000163531, ENSMUST00000168438

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4841 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location97689824-97888707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 97793528 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 220 (H220L)
Ref Sequence ENSEMBL: ENSMUSP00000088254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090750] [ENSMUST00000107038] [ENSMUST00000168438] [ENSMUST00000200232]
Predicted Effect probably damaging
Transcript: ENSMUST00000090750
AA Change: H220L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088254
Gene: ENSMUSG00000038170
AA Change: H220L

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
low complexity region 45 57 N/A INTRINSIC
Pfam:Cnn_1N 124 196 3.2e-26 PFAM
low complexity region 204 219 N/A INTRINSIC
coiled coil region 282 325 N/A INTRINSIC
internal_repeat_1 397 438 4.03e-5 PROSPERO
low complexity region 567 578 N/A INTRINSIC
internal_repeat_2 617 667 6.59e-5 PROSPERO
internal_repeat_1 620 661 4.03e-5 PROSPERO
coiled coil region 866 942 N/A INTRINSIC
low complexity region 1038 1056 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
coiled coil region 1118 1163 N/A INTRINSIC
coiled coil region 1336 1363 N/A INTRINSIC
low complexity region 1403 1420 N/A INTRINSIC
coiled coil region 1470 1508 N/A INTRINSIC
internal_repeat_2 1597 1644 6.59e-5 PROSPERO
DUF1220 1680 1747 1.17e-17 SMART
low complexity region 1758 1780 N/A INTRINSIC
low complexity region 1836 1851 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
low complexity region 1940 1951 N/A INTRINSIC
coiled coil region 1962 2138 N/A INTRINSIC
coiled coil region 2162 2197 N/A INTRINSIC
coiled coil region 2387 2431 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107038
AA Change: H166L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102653
Gene: ENSMUSG00000038170
AA Change: H166L

DomainStartEndE-ValueType
Pfam:Microtub_assoc 70 144 7.8e-32 PFAM
low complexity region 150 165 N/A INTRINSIC
coiled coil region 228 271 N/A INTRINSIC
internal_repeat_1 343 384 5.54e-5 PROSPERO
low complexity region 513 524 N/A INTRINSIC
internal_repeat_1 566 607 5.54e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000168438
AA Change: H220L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131170
Gene: ENSMUSG00000038170
AA Change: H220L

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
low complexity region 45 57 N/A INTRINSIC
Pfam:Microtub_assoc 124 198 1.4e-31 PFAM
low complexity region 204 219 N/A INTRINSIC
coiled coil region 282 325 N/A INTRINSIC
internal_repeat_1 397 438 3.56e-5 PROSPERO
low complexity region 567 578 N/A INTRINSIC
internal_repeat_2 617 667 5.83e-5 PROSPERO
internal_repeat_1 620 661 3.56e-5 PROSPERO
coiled coil region 866 942 N/A INTRINSIC
low complexity region 1038 1056 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
coiled coil region 1118 1163 N/A INTRINSIC
coiled coil region 1336 1363 N/A INTRINSIC
low complexity region 1403 1420 N/A INTRINSIC
coiled coil region 1470 1508 N/A INTRINSIC
internal_repeat_2 1597 1644 5.83e-5 PROSPERO
DUF1220 1680 1747 1.17e-17 SMART
low complexity region 1758 1769 N/A INTRINSIC
low complexity region 1785 1800 N/A INTRINSIC
low complexity region 1809 1823 N/A INTRINSIC
low complexity region 1889 1900 N/A INTRINSIC
coiled coil region 1911 2087 N/A INTRINSIC
coiled coil region 2111 2146 N/A INTRINSIC
coiled coil region 2336 2380 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200232
SMART Domains Protein: ENSMUSP00000142941
Gene: ENSMUSG00000038170

DomainStartEndE-ValueType
Pfam:Microtub_assoc 4 72 9.6e-28 PFAM
Meta Mutation Damage Score 0.0224 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene serves to anchor phosphodiesterase 4D to the Golgi/centrosome region of the cell. Defects in this gene may be a cause of myeloproliferative disorder (MBD) associated with eosinophilia. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit partial (in utero or perinatal) lethality, hyperactivity, and increased vertical activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik A T 17: 14,943,739 I43L possibly damaging Het
4933427I04Rik T A 4: 123,860,377 M28K probably benign Het
9530053A07Rik T A 7: 28,150,722 C1198S probably damaging Het
A2m A T 6: 121,646,844 I390F probably benign Het
Abcc8 T C 7: 46,150,828 K510R probably damaging Het
Adamts6 A G 13: 104,312,787 D39G probably benign Het
Adgrl3 T C 5: 81,794,271 S1326P possibly damaging Het
Adgrv1 A G 13: 81,503,001 probably null Het
Ap3b2 G A 7: 81,477,930 A166V probably damaging Het
Bbox1 T A 2: 110,303,739 probably null Het
BC067074 G A 13: 113,366,190 G143D probably benign Het
Bckdk A G 7: 127,905,461 probably null Het
Cand1 C A 10: 119,213,546 probably null Het
Capn5 T C 7: 98,131,672 probably null Het
Cd209c G T 8: 3,945,905 R2S probably benign Het
Ces1g C T 8: 93,333,695 E99K probably benign Het
Cnmd A G 14: 79,650,322 I153T possibly damaging Het
Cntrob C G 11: 69,315,394 L315F possibly damaging Het
Ctdp1 A G 18: 80,408,726 S145P unknown Het
Dmrt2 G A 19: 25,677,667 G210D probably damaging Het
Dnajc16 A G 4: 141,774,625 F298S probably damaging Het
Dock5 T C 14: 67,817,563 D618G probably damaging Het
Drc3 G A 11: 60,370,535 A171T probably benign Het
Dspp A T 5: 104,177,186 S472C unknown Het
Dspp G T 5: 104,177,187 S472I unknown Het
Ecel1 A T 1: 87,153,301 N322K probably damaging Het
Eftud2 A G 11: 102,854,814 F362L probably damaging Het
Egfr C T 11: 16,911,607 H1129Y probably benign Het
Erich3 T A 3: 154,704,843 F112I possibly damaging Het
Fam107b T C 2: 3,778,543 L261S probably damaging Het
Fam198b G A 3: 79,936,605 R377H probably damaging Het
Fam19a5 C T 15: 87,625,436 probably benign Het
Fancd2 T C 6: 113,562,430 S239P probably damaging Het
Fbp2 C A 13: 62,854,913 Q108H probably benign Het
Gipr C T 7: 19,162,676 R165H probably damaging Het
Gje1 C T 10: 14,717,338 G45R probably null Het
Gm6588 A T 5: 112,450,240 K218* probably null Het
Gpat2 C G 2: 127,433,967 T555S probably benign Het
Grik3 C A 4: 125,691,176 N612K probably damaging Het
Iqcb1 A G 16: 36,835,590 E113G probably benign Het
Kat8 A G 7: 127,925,194 I415V probably benign Het
Kcnk10 A T 12: 98,434,916 M486K probably benign Het
Kif21b C A 1: 136,145,220 H119N probably damaging Het
Leng9 T C 7: 4,149,386 D97G probably damaging Het
Lrguk T C 6: 34,092,867 V559A probably damaging Het
Lrp1 G T 10: 127,583,936 R935S probably damaging Het
Lrrcc1 C A 3: 14,562,511 D503E probably benign Het
Mybph A T 1: 134,198,495 E349V probably damaging Het
Myzap A G 9: 71,548,755 S328P probably damaging Het
Nbeal1 T C 1: 60,253,375 L1062P probably damaging Het
Nepro G A 16: 44,734,797 S412N probably null Het
Nudt5 T C 2: 5,864,428 V155A probably benign Het
Olfr1301 C G 2: 111,754,334 F28L probably benign Het
Olfr291 G T 7: 84,857,120 L250F probably damaging Het
Olfr522 A G 7: 140,162,689 L87P possibly damaging Het
Olfr539 A T 7: 140,667,589 I94F probably damaging Het
Osbpl3 T A 6: 50,309,376 N623I probably damaging Het
Pde9a T A 17: 31,443,161 probably null Het
Pex16 T G 2: 92,379,199 probably null Het
Pnpla7 A G 2: 24,980,052 T15A probably benign Het
Polq G T 16: 37,048,783 probably null Het
Ppfia2 C T 10: 106,854,957 T553I probably benign Het
Rreb1 G A 13: 37,916,526 C211Y probably benign Het
Rundc3b A G 5: 8,528,742 L222P probably damaging Het
Ryr3 T C 2: 112,648,373 N4405S probably damaging Het
Sardh A G 2: 27,191,955 V853A probably benign Het
Scfd1 T C 12: 51,389,326 V86A probably damaging Het
Scube3 G A 17: 28,164,123 C425Y probably damaging Het
Sfta2 T C 17: 35,649,881 probably benign Het
Sh3d19 T C 3: 86,123,742 Y738H probably damaging Het
Shc2 T C 10: 79,622,461 R463G probably damaging Het
Slc4a10 T C 2: 62,257,595 V414A possibly damaging Het
Slc9a3 G T 13: 74,165,837 D755Y probably damaging Het
Snrpb2 C A 2: 143,068,317 F98L possibly damaging Het
Socs7 T A 11: 97,377,003 I320N possibly damaging Het
Speer2 A T 16: 69,858,100 M159K probably benign Het
Sppl2c A C 11: 104,187,652 H426P probably benign Het
Stxbp5 C A 10: 9,762,891 V1055L probably benign Het
Synpo A T 18: 60,603,612 S421T probably damaging Het
Taf6l A G 19: 8,782,406 V135A possibly damaging Het
Trim58 G A 11: 58,651,324 G370E probably damaging Het
Tshz2 T A 2: 169,886,247 I452N probably damaging Het
Ttc41 C T 10: 86,731,125 R552C probably benign Het
Vit T C 17: 78,601,879 S252P probably benign Het
Vmn1r173 A T 7: 23,702,936 I199F probably damaging Het
Vmn2r114 T A 17: 23,310,362 R255S probably benign Het
Vmn2r17 A G 5: 109,434,380 N545S probably damaging Het
Zbtb44 T G 9: 31,053,405 V37G probably damaging Het
Zfp865 A G 7: 5,031,641 Y875C probably damaging Het
Other mutations in Pde4dip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Pde4dip APN 3 97767277 missense probably benign 0.00
IGL00543:Pde4dip APN 3 97757624 missense possibly damaging 0.91
IGL00979:Pde4dip APN 3 97747758 splice site probably benign
IGL01483:Pde4dip APN 3 97754149 missense probably damaging 1.00
IGL02122:Pde4dip APN 3 97767421 missense probably damaging 1.00
IGL02398:Pde4dip APN 3 97766781 missense probably benign
IGL02814:Pde4dip APN 3 97767100 missense probably damaging 1.00
IGL02826:Pde4dip APN 3 97767087 missense probably damaging 1.00
D3080:Pde4dip UTSW 3 97766830 missense probably damaging 1.00
R0077:Pde4dip UTSW 3 97753126 nonsense probably null
R0096:Pde4dip UTSW 3 97767467 missense probably damaging 0.99
R0277:Pde4dip UTSW 3 97843712 missense probably benign 0.01
R0304:Pde4dip UTSW 3 97843712 missense probably benign 0.01
R0616:Pde4dip UTSW 3 97747533 missense probably benign 0.09
R0676:Pde4dip UTSW 3 97717097 splice site probably benign
R1166:Pde4dip UTSW 3 97713196 missense possibly damaging 0.94
R1376:Pde4dip UTSW 3 97743217 missense probably damaging 0.99
R1376:Pde4dip UTSW 3 97743217 missense probably damaging 0.99
R1452:Pde4dip UTSW 3 97724102 missense probably damaging 1.00
R1550:Pde4dip UTSW 3 97719704 missense probably damaging 1.00
R1700:Pde4dip UTSW 3 97703323 missense probably benign 0.00
R1704:Pde4dip UTSW 3 97754260 missense probably benign 0.28
R1769:Pde4dip UTSW 3 97695930 missense probably benign 0.00
R1934:Pde4dip UTSW 3 97692691 missense possibly damaging 0.74
R1980:Pde4dip UTSW 3 97756996 missense possibly damaging 0.93
R2088:Pde4dip UTSW 3 97754433 missense probably null 1.00
R2143:Pde4dip UTSW 3 97888519 missense possibly damaging 0.86
R2149:Pde4dip UTSW 3 97792836 missense possibly damaging 0.64
R2156:Pde4dip UTSW 3 97724218 missense probably damaging 0.98
R2158:Pde4dip UTSW 3 97757621 missense probably benign 0.15
R2240:Pde4dip UTSW 3 97724164 missense probably benign 0.00
R2249:Pde4dip UTSW 3 97793525 missense probably damaging 1.00
R2256:Pde4dip UTSW 3 97718184 missense probably damaging 1.00
R2680:Pde4dip UTSW 3 97701617 missense possibly damaging 0.92
R2921:Pde4dip UTSW 3 97719569 missense probably benign
R3407:Pde4dip UTSW 3 97754468 missense probably damaging 1.00
R3736:Pde4dip UTSW 3 97724111 missense probably damaging 1.00
R3787:Pde4dip UTSW 3 97715552 missense possibly damaging 0.80
R3883:Pde4dip UTSW 3 97713188 missense probably damaging 1.00
R4437:Pde4dip UTSW 3 97766569 missense possibly damaging 0.52
R4528:Pde4dip UTSW 3 97717022 missense probably damaging 1.00
R4576:Pde4dip UTSW 3 97754249 missense probably damaging 1.00
R4600:Pde4dip UTSW 3 97695944 missense probably damaging 0.98
R4653:Pde4dip UTSW 3 97767338 missense probably damaging 0.99
R4678:Pde4dip UTSW 3 97695005 missense probably damaging 1.00
R4679:Pde4dip UTSW 3 97695005 missense probably damaging 1.00
R4688:Pde4dip UTSW 3 97843677 nonsense probably null
R4770:Pde4dip UTSW 3 97767084 missense probably damaging 1.00
R4842:Pde4dip UTSW 3 97793528 missense probably damaging 1.00
R4899:Pde4dip UTSW 3 97709558 missense probably damaging 1.00
R4914:Pde4dip UTSW 3 97715328 missense probably benign 0.10
R4943:Pde4dip UTSW 3 97755511 missense probably damaging 0.99
R5131:Pde4dip UTSW 3 97709514 missense probably damaging 0.98
R5408:Pde4dip UTSW 3 97796736 missense probably benign 0.35
R5583:Pde4dip UTSW 3 97747576 missense possibly damaging 0.67
R5677:Pde4dip UTSW 3 97841648 nonsense probably null
R5689:Pde4dip UTSW 3 97692367 nonsense probably null
R5696:Pde4dip UTSW 3 97709490 missense probably damaging 1.00
R5860:Pde4dip UTSW 3 97724188 missense possibly damaging 0.68
R6279:Pde4dip UTSW 3 97699180 missense probably damaging 1.00
R6341:Pde4dip UTSW 3 97694911 missense probably benign
R6440:Pde4dip UTSW 3 97767586 missense probably damaging 1.00
R6464:Pde4dip UTSW 3 97710344 missense probably damaging 1.00
R6489:Pde4dip UTSW 3 97755591 nonsense probably null
R6706:Pde4dip UTSW 3 97741393 missense probably damaging 1.00
R6722:Pde4dip UTSW 3 97718239 nonsense probably null
R6798:Pde4dip UTSW 3 97888534 missense probably benign
R6804:Pde4dip UTSW 3 97793248 nonsense probably null
R6862:Pde4dip UTSW 3 97767024 missense possibly damaging 0.52
R6957:Pde4dip UTSW 3 97824333 splice site probably null
R6983:Pde4dip UTSW 3 97718236 missense probably damaging 1.00
R7014:Pde4dip UTSW 3 97715422 missense possibly damaging 0.54
R7025:Pde4dip UTSW 3 97724183 nonsense probably null
R7136:Pde4dip UTSW 3 97694063 missense probably benign 0.03
R7178:Pde4dip UTSW 3 97715630 missense probably benign 0.26
R7269:Pde4dip UTSW 3 97766959 missense probably damaging 1.00
R7283:Pde4dip UTSW 3 97758882 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCTAAGAGGTGGTAGGTCCTAC -3'
(R):5'- AAGGCTGGACAGAGTGGTTC -3'

Sequencing Primer
(F):5'- TACCCAGGTCAGGCATCTG -3'
(R):5'- CAATGCAGAGCAAGTGTTTCTCTG -3'
Posted On2016-03-01