Incidental Mutation 'R4841:Dspp'
ID371814
Institutional Source Beutler Lab
Gene Symbol Dspp
Ensembl Gene ENSMUSG00000053268
Gene Namedentin sialophosphoprotein
SynonymsDmp3, Dsp, Dpp
MMRRC Submission 042454-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4841 (G1)
Quality Score118
Status Not validated
Chromosome5
Chromosomal Location104170712-104180127 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104177186 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 472 (S472C)
Ref Sequence ENSEMBL: ENSMUSP00000108391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112771]
Predicted Effect unknown
Transcript: ENSMUST00000112771
AA Change: S472C
SMART Domains Protein: ENSMUSP00000108391
Gene: ENSMUSG00000053268
AA Change: S472C

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 52 67 N/A INTRINSIC
internal_repeat_1 82 245 2.01e-11 PROSPERO
low complexity region 247 268 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
internal_repeat_1 285 438 2.01e-11 PROSPERO
internal_repeat_2 286 369 2.15e-10 PROSPERO
internal_repeat_2 370 454 2.15e-10 PROSPERO
low complexity region 456 472 N/A INTRINSIC
low complexity region 481 944 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the small integrin-binding ligand N-linked glycoprotein (SIBLING) family of proteins. The encoded preproprotein is secreted by odontoblasts and proteolytically processed to generate two principal proteins of the dentin extracellular matrix of the tooth, dentin sialoprotein and dentin phosphoprotein. These two protein products may play distinct but related roles in dentin mineralization. Mice lacking the encoded protein exhibit hypomineralization defects in dentin, similar to human dentinogenesis imperfecta. [provided by RefSeq, Feb 2016]
PHENOTYPE: Aging mice homozygous for a reporter/null allele display tooth abnormalities, including enlarged pulp cavities, a widened predentin zone, dentin hypomineralization, pulp exposure, and occasional brittle incisors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik A T 17: 14,943,739 I43L possibly damaging Het
4933427I04Rik T A 4: 123,860,377 M28K probably benign Het
9530053A07Rik T A 7: 28,150,722 C1198S probably damaging Het
A2m A T 6: 121,646,844 I390F probably benign Het
Abcc8 T C 7: 46,150,828 K510R probably damaging Het
Adamts6 A G 13: 104,312,787 D39G probably benign Het
Adgrl3 T C 5: 81,794,271 S1326P possibly damaging Het
Adgrv1 A G 13: 81,503,001 probably null Het
Ap3b2 G A 7: 81,477,930 A166V probably damaging Het
Bbox1 T A 2: 110,303,739 probably null Het
BC067074 G A 13: 113,366,190 G143D probably benign Het
Bckdk A G 7: 127,905,461 probably null Het
Cand1 C A 10: 119,213,546 probably null Het
Capn5 T C 7: 98,131,672 probably null Het
Cd209c G T 8: 3,945,905 R2S probably benign Het
Ces1g C T 8: 93,333,695 E99K probably benign Het
Cnmd A G 14: 79,650,322 I153T possibly damaging Het
Cntrob C G 11: 69,315,394 L315F possibly damaging Het
Ctdp1 A G 18: 80,408,726 S145P unknown Het
Dmrt2 G A 19: 25,677,667 G210D probably damaging Het
Dnajc16 A G 4: 141,774,625 F298S probably damaging Het
Dock5 T C 14: 67,817,563 D618G probably damaging Het
Drc3 G A 11: 60,370,535 A171T probably benign Het
Ecel1 A T 1: 87,153,301 N322K probably damaging Het
Eftud2 A G 11: 102,854,814 F362L probably damaging Het
Egfr C T 11: 16,911,607 H1129Y probably benign Het
Erich3 T A 3: 154,704,843 F112I possibly damaging Het
Fam107b T C 2: 3,778,543 L261S probably damaging Het
Fam198b G A 3: 79,936,605 R377H probably damaging Het
Fam19a5 C T 15: 87,625,436 probably benign Het
Fancd2 T C 6: 113,562,430 S239P probably damaging Het
Fbp2 C A 13: 62,854,913 Q108H probably benign Het
Gipr C T 7: 19,162,676 R165H probably damaging Het
Gje1 C T 10: 14,717,338 G45R probably null Het
Gm6588 A T 5: 112,450,240 K218* probably null Het
Gpat2 C G 2: 127,433,967 T555S probably benign Het
Grik3 C A 4: 125,691,176 N612K probably damaging Het
Iqcb1 A G 16: 36,835,590 E113G probably benign Het
Kat8 A G 7: 127,925,194 I415V probably benign Het
Kcnk10 A T 12: 98,434,916 M486K probably benign Het
Kif21b C A 1: 136,145,220 H119N probably damaging Het
Leng9 T C 7: 4,149,386 D97G probably damaging Het
Lrguk T C 6: 34,092,867 V559A probably damaging Het
Lrp1 G T 10: 127,583,936 R935S probably damaging Het
Lrrcc1 C A 3: 14,562,511 D503E probably benign Het
Mybph A T 1: 134,198,495 E349V probably damaging Het
Myzap A G 9: 71,548,755 S328P probably damaging Het
Nbeal1 T C 1: 60,253,375 L1062P probably damaging Het
Nepro G A 16: 44,734,797 S412N probably null Het
Nudt5 T C 2: 5,864,428 V155A probably benign Het
Olfr1301 C G 2: 111,754,334 F28L probably benign Het
Olfr291 G T 7: 84,857,120 L250F probably damaging Het
Olfr522 A G 7: 140,162,689 L87P possibly damaging Het
Olfr539 A T 7: 140,667,589 I94F probably damaging Het
Osbpl3 T A 6: 50,309,376 N623I probably damaging Het
Pde4dip T A 3: 97,793,528 H220L probably damaging Het
Pde9a T A 17: 31,443,161 probably null Het
Pex16 T G 2: 92,379,199 probably null Het
Pnpla7 A G 2: 24,980,052 T15A probably benign Het
Polq G T 16: 37,048,783 probably null Het
Ppfia2 C T 10: 106,854,957 T553I probably benign Het
Rreb1 G A 13: 37,916,526 C211Y probably benign Het
Rundc3b A G 5: 8,528,742 L222P probably damaging Het
Ryr3 T C 2: 112,648,373 N4405S probably damaging Het
Sardh A G 2: 27,191,955 V853A probably benign Het
Scfd1 T C 12: 51,389,326 V86A probably damaging Het
Scube3 G A 17: 28,164,123 C425Y probably damaging Het
Sfta2 T C 17: 35,649,881 probably benign Het
Sh3d19 T C 3: 86,123,742 Y738H probably damaging Het
Shc2 T C 10: 79,622,461 R463G probably damaging Het
Slc4a10 T C 2: 62,257,595 V414A possibly damaging Het
Slc9a3 G T 13: 74,165,837 D755Y probably damaging Het
Snrpb2 C A 2: 143,068,317 F98L possibly damaging Het
Socs7 T A 11: 97,377,003 I320N possibly damaging Het
Speer2 A T 16: 69,858,100 M159K probably benign Het
Sppl2c A C 11: 104,187,652 H426P probably benign Het
Stxbp5 C A 10: 9,762,891 V1055L probably benign Het
Synpo A T 18: 60,603,612 S421T probably damaging Het
Taf6l A G 19: 8,782,406 V135A possibly damaging Het
Trim58 G A 11: 58,651,324 G370E probably damaging Het
Tshz2 T A 2: 169,886,247 I452N probably damaging Het
Ttc41 C T 10: 86,731,125 R552C probably benign Het
Vit T C 17: 78,601,879 S252P probably benign Het
Vmn1r173 A T 7: 23,702,936 I199F probably damaging Het
Vmn2r114 T A 17: 23,310,362 R255S probably benign Het
Vmn2r17 A G 5: 109,434,380 N545S probably damaging Het
Zbtb44 T G 9: 31,053,405 V37G probably damaging Het
Zfp865 A G 7: 5,031,641 Y875C probably damaging Het
Other mutations in Dspp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Dspp APN 5 104176892 missense possibly damaging 0.95
IGL01096:Dspp APN 5 104175367 missense possibly damaging 0.92
IGL01317:Dspp APN 5 104174048 missense probably damaging 0.99
IGL02365:Dspp APN 5 104176061 missense probably damaging 1.00
IGL02387:Dspp APN 5 104175624 missense possibly damaging 0.82
IGL02406:Dspp APN 5 104177366 nonsense probably null
IGL02445:Dspp APN 5 104177097 missense probably damaging 0.99
IGL02481:Dspp APN 5 104175648 missense possibly damaging 0.94
IGL02536:Dspp APN 5 104175665 missense probably damaging 0.99
IGL02572:Dspp APN 5 104177069 missense probably damaging 0.99
IGL02677:Dspp APN 5 104175977 missense possibly damaging 0.78
IGL02709:Dspp APN 5 104177250 missense unknown
IGL02723:Dspp APN 5 104175175 missense probably benign 0.03
IGL02740:Dspp APN 5 104177238 nonsense probably null
IGL03274:Dspp APN 5 104174948 missense probably damaging 0.99
IGL03293:Dspp APN 5 104177561 missense unknown
FR4449:Dspp UTSW 5 104178388 small deletion probably benign
R0018:Dspp UTSW 5 104178230 missense unknown
R0125:Dspp UTSW 5 104178039 missense unknown
R0503:Dspp UTSW 5 104177256 missense unknown
R1709:Dspp UTSW 5 104175724 missense probably damaging 0.98
R1851:Dspp UTSW 5 104174085 critical splice donor site probably null
R2001:Dspp UTSW 5 104178559 missense unknown
R2002:Dspp UTSW 5 104178559 missense unknown
R2198:Dspp UTSW 5 104175701 missense probably benign 0.37
R2279:Dspp UTSW 5 104178384 missense unknown
R4026:Dspp UTSW 5 104177697 missense unknown
R4066:Dspp UTSW 5 104177194 missense unknown
R4632:Dspp UTSW 5 104177406 missense unknown
R4693:Dspp UTSW 5 104178062 missense unknown
R4841:Dspp UTSW 5 104177187 missense unknown
R4917:Dspp UTSW 5 104177923 missense unknown
R5008:Dspp UTSW 5 104175573 missense possibly damaging 0.66
R5015:Dspp UTSW 5 104177060 missense possibly damaging 0.46
R5214:Dspp UTSW 5 104178498 missense unknown
R5359:Dspp UTSW 5 104175886 missense probably damaging 0.98
R5538:Dspp UTSW 5 104175230 nonsense probably null
R5703:Dspp UTSW 5 104177051 missense possibly damaging 0.82
R5887:Dspp UTSW 5 104175455 missense probably damaging 1.00
R5902:Dspp UTSW 5 104178111 missense unknown
R5992:Dspp UTSW 5 104178451 missense unknown
R6019:Dspp UTSW 5 104178039 missense unknown
R6191:Dspp UTSW 5 104177348 missense unknown
R6362:Dspp UTSW 5 104176034 missense probably benign 0.19
R6736:Dspp UTSW 5 104178175 missense unknown
R6805:Dspp UTSW 5 104175850 missense probably benign 0.03
R7064:Dspp UTSW 5 104176938 missense possibly damaging 0.73
R7178:Dspp UTSW 5 104174066 missense probably benign 0.02
R7243:Dspp UTSW 5 104178361 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CAAGGCACTGCTGAGAAATCAG -3'
(R):5'- TTGTCATGGTCACTGCTGTC -3'

Sequencing Primer
(F):5'- AGCTGCCCACAGTAACCTGG -3'
(R):5'- CATGGTCACTGCTGTCAGATTCG -3'
Posted On2016-03-01