Incidental Mutation 'R0239:Ikbkap'
ID37185
Institutional Source Beutler Lab
Gene Symbol Ikbkap
Ensembl Gene ENSMUSG00000028431
Gene Nameinhibitor of kappa light polypeptide enhancer in B cells, kinase complex-associated protein
SynonymsC78473, Elp1, IKAP, 3110040G09Rik
MMRRC Submission 038477-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0239 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location56749680-56802331 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 56784596 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 466 (V466L)
Ref Sequence ENSEMBL: ENSMUSP00000030140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030140]
Predicted Effect probably benign
Transcript: ENSMUST00000030140
AA Change: V466L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000030140
Gene: ENSMUSG00000028431
AA Change: V466L

DomainStartEndE-ValueType
Pfam:IKI3 1 955 N/A PFAM
low complexity region 1186 1205 N/A INTRINSIC
low complexity region 1210 1225 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126441
Meta Mutation Damage Score 0.184 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.9%
Validation Efficiency 100% (3/3)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a scaffold protein and a regulator for three different kinases involved in proinflammatory signaling. The encoded protein can bind NF-kappa-B-inducing kinase and I-kappa-B kinases through separate domains and assemble them into an active kinase complex. Mutations in this gene have been associated with familial dysautonomia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality with arrested neural and vascular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik TTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCC 3: 138,065,834 probably benign Het
Adra1d C A 2: 131,546,214 V474F probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Ash1l A G 3: 89,067,222 D2618G possibly damaging Het
Atp6v1c2 C A 12: 17,294,675 probably null Het
Cacna1d A G 14: 30,123,496 V572A probably benign Het
Camta1 A G 4: 151,143,730 W882R probably damaging Het
Cd72 A G 4: 43,453,163 V91A probably benign Het
Cdh12 T C 15: 21,586,407 W771R probably damaging Het
Cdx2 G T 5: 147,303,287 T193K probably damaging Het
Cfap70 A C 14: 20,448,605 S5A probably benign Het
Chmp7 A G 14: 69,720,997 V241A probably damaging Het
D3Ertd751e A G 3: 41,753,878 Y150C probably damaging Het
Depdc5 T C 5: 32,943,240 S832P probably damaging Het
Dnhd1 A G 7: 105,721,531 S4673G probably benign Het
Dock4 G T 12: 40,737,540 S818I probably damaging Het
Dysf C T 6: 84,064,479 Q156* probably null Het
Espnl T C 1: 91,322,287 V52A probably damaging Het
Flcn T C 11: 59,801,076 N249S probably benign Het
Gemin6 C A 17: 80,225,710 A24D probably damaging Het
Gm5773 A G 3: 93,774,032 H337R probably benign Het
Gm9733 A G 3: 15,296,601 L163P probably damaging Het
Hal T C 10: 93,503,482 S478P possibly damaging Het
Hectd1 T A 12: 51,769,318 M1324L possibly damaging Het
Hyal5 T A 6: 24,876,344 L72Q probably damaging Het
Ift140 C A 17: 25,045,523 C557* probably null Het
Kbtbd3 G T 9: 4,330,144 V173L possibly damaging Het
Kif14 A G 1: 136,527,393 E1551G probably damaging Het
Krt17 G A 11: 100,260,878 R30* probably null Het
Lamb3 A T 1: 193,321,053 D100V probably damaging Het
Map2 A G 1: 66,416,106 D1385G probably damaging Het
Mettl25 C T 10: 105,826,525 V195I probably damaging Het
Myh8 A G 11: 67,301,692 T1466A probably benign Het
Myo3b T A 2: 70,105,425 C61S probably benign Het
Nacc2 T G 2: 26,062,261 N361T probably damaging Het
Nf1 A T 11: 79,418,574 K438M possibly damaging Het
Nipal4 A G 11: 46,150,441 V309A possibly damaging Het
Nomo1 T C 7: 46,079,594 probably null Het
Nubp2 T C 17: 24,884,471 E144G probably damaging Het
Nwd2 A T 5: 63,800,124 I266F probably benign Het
Olfr1126 T C 2: 87,458,037 F291L probably benign Het
Olfr593 G A 7: 103,212,726 V289M possibly damaging Het
Olfr694 A G 7: 106,689,255 Y159H probably benign Het
Orc1 T C 4: 108,595,646 probably null Het
Otogl T A 10: 107,806,696 N1291I probably damaging Het
Pah C T 10: 87,567,281 P173S possibly damaging Het
Pga5 A G 19: 10,669,453 Y305H probably damaging Het
Plekha4 A G 7: 45,532,358 H62R probably damaging Het
Plxnd1 G T 6: 115,968,793 D906E probably benign Het
Ppfia4 T C 1: 134,329,189 E98G possibly damaging Het
Ptk2 A T 15: 73,343,283 probably null Het
Raet1e C A 10: 22,180,862 H112Q possibly damaging Het
Scai T A 2: 39,075,042 I597F probably benign Het
Slc35c2 C T 2: 165,280,837 G176S probably damaging Het
Slc35f4 A T 14: 49,304,256 I347N possibly damaging Het
Slc52a3 T C 2: 152,008,156 *461Q probably null Het
Slc6a1 G A 6: 114,302,800 V142I probably benign Het
Tbc1d31 C A 15: 57,940,753 T388N probably benign Het
Tmem63c T C 12: 87,075,639 W404R probably damaging Het
Tmem79 A G 3: 88,333,321 S107P probably benign Het
Trip11 C T 12: 101,884,728 E741K probably damaging Het
Trpm5 G T 7: 143,082,958 T414N probably damaging Het
Tsnaxip1 T A 8: 105,844,488 I660N possibly damaging Het
Ube2q2 T C 9: 55,163,007 S78P probably damaging Het
Vac14 A T 8: 110,635,375 probably null Het
Vps51 G T 19: 6,071,437 S185* probably null Het
Zfp11 C T 5: 129,658,238 G53E possibly damaging Het
Zfp532 A T 18: 65,682,985 I810F possibly damaging Het
Zfp599 C T 9: 22,249,759 C370Y probably damaging Het
Other mutations in Ikbkap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Ikbkap APN 4 56784537 critical splice donor site probably null
IGL01521:Ikbkap APN 4 56771059 missense probably benign 0.27
IGL02069:Ikbkap APN 4 56779731 missense probably benign 0.31
IGL02162:Ikbkap APN 4 56796502 critical splice donor site probably null
IGL02252:Ikbkap APN 4 56759813 missense probably benign 0.09
IGL02726:Ikbkap APN 4 56767878 critical splice acceptor site probably null
IGL02822:Ikbkap APN 4 56774520 critical splice donor site probably null
IGL03024:Ikbkap APN 4 56774686 critical splice donor site probably null
IGL03126:Ikbkap APN 4 56779717 missense probably benign
R0211:Ikbkap UTSW 4 56795545 missense probably damaging 1.00
R0239:Ikbkap UTSW 4 56784596 missense probably benign 0.00
R0603:Ikbkap UTSW 4 56792105 missense possibly damaging 0.94
R1109:Ikbkap UTSW 4 56786723 missense probably benign 0.00
R1314:Ikbkap UTSW 4 56786647 missense probably benign 0.00
R1333:Ikbkap UTSW 4 56770969 splice site probably benign
R1434:Ikbkap UTSW 4 56781193 missense probably benign 0.02
R1547:Ikbkap UTSW 4 56792090 missense probably damaging 1.00
R1547:Ikbkap UTSW 4 56798810 missense probably damaging 1.00
R1587:Ikbkap UTSW 4 56786666 nonsense probably null
R1601:Ikbkap UTSW 4 56774756 nonsense probably null
R2076:Ikbkap UTSW 4 56786620 missense probably damaging 0.98
R2153:Ikbkap UTSW 4 56779636 intron probably null
R2263:Ikbkap UTSW 4 56755298 splice site probably null
R2325:Ikbkap UTSW 4 56784622 missense probably benign 0.00
R2333:Ikbkap UTSW 4 56775456 missense probably benign 0.28
R3151:Ikbkap UTSW 4 56770985 missense probably benign 0.24
R3622:Ikbkap UTSW 4 56759925 splice site probably null
R3624:Ikbkap UTSW 4 56798708 missense possibly damaging 0.52
R3889:Ikbkap UTSW 4 56759852 missense probably damaging 1.00
R4007:Ikbkap UTSW 4 56794139 missense probably damaging 1.00
R4196:Ikbkap UTSW 4 56755353 missense probably damaging 1.00
R4794:Ikbkap UTSW 4 56781176 small deletion probably benign
R5330:Ikbkap UTSW 4 56800001 missense probably benign 0.01
R5331:Ikbkap UTSW 4 56800001 missense probably benign 0.01
R5360:Ikbkap UTSW 4 56800104 missense probably benign 0.06
R5362:Ikbkap UTSW 4 56778969 missense probably damaging 0.99
R5645:Ikbkap UTSW 4 56776920 missense possibly damaging 0.93
R5877:Ikbkap UTSW 4 56787807 missense probably damaging 1.00
R6268:Ikbkap UTSW 4 56762305 missense probably damaging 1.00
R6284:Ikbkap UTSW 4 56762281 missense probably damaging 0.99
R6526:Ikbkap UTSW 4 56798812 critical splice acceptor site probably null
R6610:Ikbkap UTSW 4 56758236 missense probably benign 0.02
R6627:Ikbkap UTSW 4 56784647 splice site probably null
R6786:Ikbkap UTSW 4 56771555 missense possibly damaging 0.80
R6823:Ikbkap UTSW 4 56787939 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAGTCTCCCTAGATAACAAGGTTGC -3'
(R):5'- TCTGTAGTGTGGGGAAGACAGTCC -3'

Sequencing Primer
(F):5'- GATGGGACATGACCCTATCTTC -3'
(R):5'- AGGTTTTGATTGAGCCTGAAAAG -3'
Posted On2013-05-09