Incidental Mutation 'R4842:Myh7b'
ID371889
Institutional Source Beutler Lab
Gene Symbol Myh7b
Ensembl Gene ENSMUSG00000074652
Gene Namemyosin, heavy chain 7B, cardiac muscle, beta
SynonymsMyh14
MMRRC Submission 042455-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4842 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location155611212-155634307 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 155633989 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 1935 (L1935M)
Ref Sequence ENSEMBL: ENSMUSP00000090672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041059] [ENSMUST00000092995] [ENSMUST00000103140]
Predicted Effect probably benign
Transcript: ENSMUST00000041059
SMART Domains Protein: ENSMUSP00000037574
Gene: ENSMUSG00000038324

DomainStartEndE-ValueType
low complexity region 2 35 N/A INTRINSIC
low complexity region 38 53 N/A INTRINSIC
Pfam:DUF3689 407 714 5.2e-135 PFAM
low complexity region 724 735 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092995
AA Change: L1935M

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090672
Gene: ENSMUSG00000074652
AA Change: L1935M

DomainStartEndE-ValueType
Pfam:Myosin_N 32 72 4.7e-14 PFAM
MYSc 78 786 N/A SMART
IQ 787 809 2.6e0 SMART
Pfam:Myosin_tail_1 850 1931 5.5e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103140
SMART Domains Protein: ENSMUSP00000099429
Gene: ENSMUSG00000038324

DomainStartEndE-ValueType
low complexity region 2 35 N/A INTRINSIC
low complexity region 38 53 N/A INTRINSIC
Pfam:DUF3689 399 710 1.1e-138 PFAM
low complexity region 716 727 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124415
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154656
Meta Mutation Damage Score 0.0676 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 95% (107/113)
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer comprised of two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik A T 17: 14,943,739 I43L possibly damaging Het
4930449A18Rik T A 3: 59,841,732 noncoding transcript Het
9530053A07Rik T A 7: 28,150,722 C1198S probably damaging Het
Abcc8 T C 7: 46,150,828 K510R probably damaging Het
Adamtsl3 C T 7: 82,528,861 R511C probably damaging Het
Arhgap11a T C 2: 113,839,762 S339G probably damaging Het
C2cd3 A G 7: 100,416,190 T728A probably benign Het
Cand1 C A 10: 119,213,546 probably null Het
Catspere1 A T 1: 177,872,058 noncoding transcript Het
Cd209c G T 8: 3,945,905 R2S probably benign Het
Cdc16 A G 8: 13,781,644 probably benign Het
Ces1g C T 8: 93,333,695 E99K probably benign Het
Chrna7 A C 7: 63,212,448 L10R probably benign Het
Clnk C T 5: 38,713,069 probably null Het
Cntrob C G 11: 69,315,394 L315F possibly damaging Het
Ctdp1 A G 18: 80,408,726 S145P unknown Het
Dennd2a T C 6: 39,497,110 D430G probably damaging Het
Dnajc16 A G 4: 141,774,625 F298S probably damaging Het
Dock5 T C 14: 67,817,563 D618G probably damaging Het
Drc3 G A 11: 60,370,535 A171T probably benign Het
Ecel1 A T 1: 87,153,301 N322K probably damaging Het
Eftud2 A G 11: 102,854,814 F362L probably damaging Het
Egfr C T 11: 16,911,607 H1129Y probably benign Het
Eif2b1 A G 5: 124,576,908 S102P probably damaging Het
Erich3 T A 3: 154,704,843 F112I possibly damaging Het
Fam107b T C 2: 3,778,543 L261S probably damaging Het
Fam198b G A 3: 79,936,605 R377H probably damaging Het
Fat3 A C 9: 15,997,587 V2373G probably damaging Het
Gadd45a A T 6: 67,036,889 L58Q probably damaging Het
Gipr C T 7: 19,162,676 R165H probably damaging Het
Gje1 C T 10: 14,717,338 G45R probably null Het
Gldc T A 19: 30,133,732 N548I possibly damaging Het
Gm13035 A G 4: 146,073,423 noncoding transcript Het
Gm27013 T A 6: 130,520,737 noncoding transcript Het
Gm5436 A T 12: 84,258,810 noncoding transcript Het
Gm6588 A T 5: 112,450,240 K218* probably null Het
Grik3 C A 4: 125,691,176 N612K probably damaging Het
Hfm1 C A 5: 106,892,751 W716L probably damaging Het
Hist1h2bl C T 13: 21,716,064 probably benign Het
Il5ra T C 6: 106,738,375 Y166C probably damaging Het
Iqcb1 A G 16: 36,835,590 E113G probably benign Het
Kcnk10 A T 12: 98,434,916 M486K probably benign Het
Kcnv2 A G 19: 27,323,790 D347G probably damaging Het
Kif21b C A 1: 136,145,220 H119N probably damaging Het
Lamb1 C T 12: 31,287,433 H388Y probably damaging Het
Leng9 T C 7: 4,149,386 D97G probably damaging Het
Lmbr1 G A 5: 29,287,426 T55I probably damaging Het
Lrp1 G T 10: 127,583,936 R935S probably damaging Het
Lrp2 A T 2: 69,469,411 V3099E probably benign Het
Lrrcc1 C A 3: 14,562,511 D503E probably benign Het
Map1a T A 2: 121,302,086 S890T probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Mybph A T 1: 134,198,495 E349V probably damaging Het
Myh9 T C 15: 77,769,253 E1348G probably damaging Het
Myzap A G 9: 71,548,755 S328P probably damaging Het
Nbeal1 T C 1: 60,253,375 L1062P probably damaging Het
Nepro G A 16: 44,734,797 S412N probably null Het
Nr1h3 A G 2: 91,190,218 F257L probably benign Het
Nudt5 T C 2: 5,864,428 V155A probably benign Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr522 A G 7: 140,162,689 L87P possibly damaging Het
Olfr539 A T 7: 140,667,589 I94F probably damaging Het
Olfr653 A T 7: 104,580,215 I190L probably benign Het
Pde1a T A 2: 80,128,837 probably benign Het
Pde4dip T A 3: 97,793,528 H220L probably damaging Het
Pde9a T A 17: 31,443,161 probably null Het
Pnkp C A 7: 44,861,646 probably null Het
Pnpla7 A G 2: 24,980,052 T15A probably benign Het
Polq G T 16: 37,048,783 probably null Het
Ppfia2 C T 10: 106,854,957 T553I probably benign Het
Ptk6 T G 2: 181,196,991 N323T possibly damaging Het
Rhox3c G A X: 37,470,424 A60T probably damaging Het
Rnf4 T A 5: 34,348,709 V61E probably damaging Het
Rnf5 A G 17: 34,602,003 probably benign Het
Sardh A G 2: 27,191,955 V853A probably benign Het
Scfd1 T C 12: 51,389,326 V86A probably damaging Het
Scube3 G A 17: 28,164,123 C425Y probably damaging Het
Sema5a C T 15: 32,609,417 H490Y probably benign Het
Sfta2 T C 17: 35,649,881 probably benign Het
Sh3d19 T C 3: 86,123,742 Y738H probably damaging Het
Shc2 T C 10: 79,622,461 R463G probably damaging Het
Socs7 T A 11: 97,377,003 I320N possibly damaging Het
Speer2 A T 16: 69,858,100 M159K probably benign Het
Sppl2c A C 11: 104,187,652 H426P probably benign Het
Stag3 T G 5: 138,309,365 probably null Het
Stxbp5 C A 10: 9,762,891 V1055L probably benign Het
Synpo A T 18: 60,603,612 S421T probably damaging Het
Taf6l A G 19: 8,782,406 V135A possibly damaging Het
Tas2r116 G A 6: 132,855,697 S87N probably benign Het
Tomm6 T C 17: 47,688,069 probably benign Het
Trabd T C 15: 89,082,712 M113T probably benign Het
Trim58 G A 11: 58,651,324 G370E probably damaging Het
Ttc41 C T 10: 86,731,125 R552C probably benign Het
Vit T C 17: 78,601,879 S252P probably benign Het
Vma21-ps T A 4: 52,496,943 D101V probably damaging Het
Vmn1r173 A T 7: 23,702,936 I199F probably damaging Het
Vmn2r114 T A 17: 23,310,362 R255S probably benign Het
Vmn2r17 A G 5: 109,434,380 N545S probably damaging Het
Zfp865 A G 7: 5,031,641 Y875C probably damaging Het
Other mutations in Myh7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Myh7b APN 2 155630292 missense probably damaging 0.99
IGL01604:Myh7b APN 2 155632407 missense probably damaging 0.96
IGL02179:Myh7b APN 2 155614491 missense probably benign 0.02
IGL02729:Myh7b APN 2 155625689 missense probably damaging 1.00
IGL02804:Myh7b APN 2 155625723 missense probably damaging 1.00
IGL02851:Myh7b APN 2 155628827 missense probably damaging 1.00
IGL02956:Myh7b APN 2 155632903 missense probably damaging 1.00
IGL02956:Myh7b APN 2 155625954 missense possibly damaging 0.95
IGL02992:Myh7b APN 2 155621410 missense probably damaging 0.99
IGL03060:Myh7b APN 2 155632751 missense probably damaging 1.00
IGL03061:Myh7b APN 2 155620111 missense possibly damaging 0.93
IGL03226:Myh7b APN 2 155620483 nonsense probably null
IGL03246:Myh7b APN 2 155617872 missense probably damaging 1.00
IGL03382:Myh7b APN 2 155623479 missense probably damaging 1.00
euclidian UTSW 2 155633399 missense probably benign 0.32
imaginary UTSW 2 155632255 missense probably benign 0.36
irrational UTSW 2 155630672 unclassified probably benign
muscoli UTSW 2 155620118 nonsense probably null
R0015:Myh7b UTSW 2 155622286 missense probably damaging 1.00
R0015:Myh7b UTSW 2 155622286 missense probably damaging 1.00
R0109:Myh7b UTSW 2 155611674 missense possibly damaging 0.92
R0309:Myh7b UTSW 2 155630672 unclassified probably benign
R0567:Myh7b UTSW 2 155626398 missense probably damaging 1.00
R0619:Myh7b UTSW 2 155611722 missense probably benign 0.00
R0927:Myh7b UTSW 2 155620120 missense probably damaging 1.00
R0973:Myh7b UTSW 2 155620427 missense probably benign
R0973:Myh7b UTSW 2 155620427 missense probably benign
R0974:Myh7b UTSW 2 155620427 missense probably benign
R1137:Myh7b UTSW 2 155622714 missense probably damaging 1.00
R1261:Myh7b UTSW 2 155621083 missense probably benign 0.00
R1268:Myh7b UTSW 2 155614046 nonsense probably null
R1537:Myh7b UTSW 2 155631787 missense probably damaging 0.96
R1632:Myh7b UTSW 2 155620525 missense probably benign 0.04
R1694:Myh7b UTSW 2 155613193 missense probably damaging 0.99
R1697:Myh7b UTSW 2 155620134 missense probably damaging 1.00
R1730:Myh7b UTSW 2 155625672 missense possibly damaging 0.73
R1762:Myh7b UTSW 2 155630858 missense probably damaging 0.96
R1783:Myh7b UTSW 2 155625672 missense possibly damaging 0.73
R2105:Myh7b UTSW 2 155629457 missense probably benign 0.00
R2140:Myh7b UTSW 2 155620123 missense probably damaging 1.00
R2971:Myh7b UTSW 2 155632255 missense probably benign 0.36
R3838:Myh7b UTSW 2 155632989 missense probably damaging 1.00
R4074:Myh7b UTSW 2 155618758 missense probably damaging 0.96
R4191:Myh7b UTSW 2 155633399 missense probably benign 0.32
R4689:Myh7b UTSW 2 155630514 missense possibly damaging 0.75
R4695:Myh7b UTSW 2 155614177 missense probably damaging 1.00
R4697:Myh7b UTSW 2 155629322 missense probably damaging 1.00
R4771:Myh7b UTSW 2 155626394 nonsense probably null
R4794:Myh7b UTSW 2 155623266 missense probably benign 0.00
R4871:Myh7b UTSW 2 155613500 missense probably benign 0.18
R5022:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5023:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5025:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5050:Myh7b UTSW 2 155631750 missense probably benign 0.00
R5055:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5056:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5161:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5284:Myh7b UTSW 2 155632314 missense probably benign
R5422:Myh7b UTSW 2 155631034 missense probably damaging 0.99
R5505:Myh7b UTSW 2 155632672 missense probably benign 0.01
R5946:Myh7b UTSW 2 155621395 missense probably damaging 1.00
R6089:Myh7b UTSW 2 155622489 missense probably damaging 1.00
R6103:Myh7b UTSW 2 155618743 missense probably damaging 1.00
R6233:Myh7b UTSW 2 155631799 missense possibly damaging 0.85
R6292:Myh7b UTSW 2 155632396 missense probably damaging 1.00
R6350:Myh7b UTSW 2 155628760 missense probably benign 0.00
R6484:Myh7b UTSW 2 155628643 missense probably benign 0.05
R6760:Myh7b UTSW 2 155620118 nonsense probably null
R6896:Myh7b UTSW 2 155622568 critical splice donor site probably null
R6945:Myh7b UTSW 2 155622232 missense possibly damaging 0.95
R7020:Myh7b UTSW 2 155631751 missense possibly damaging 0.56
R7052:Myh7b UTSW 2 155614133 missense probably damaging 1.00
R7102:Myh7b UTSW 2 155622199 missense probably damaging 1.00
R7248:Myh7b UTSW 2 155622186 missense probably damaging 1.00
R7303:Myh7b UTSW 2 155618740 missense probably damaging 1.00
R7360:Myh7b UTSW 2 155632540 missense probably benign 0.38
X0013:Myh7b UTSW 2 155631169 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCATTTTAGTTACCAACGGG -3'
(R):5'- GTCCATGATGTTCTGTTCCCAG -3'

Sequencing Primer
(F):5'- GAAACAAGGCTCTGCATATGGCTC -3'
(R):5'- AGTGGCTACTGCTGCAGAC -3'
Posted On2016-03-01