Incidental Mutation 'R0239:Hyal5'
ID37193
Institutional Source Beutler Lab
Gene Symbol Hyal5
Ensembl Gene ENSMUSG00000029678
Gene Namehyaluronoglucosaminidase 5
Synonyms
MMRRC Submission 038477-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.034) question?
Stock #R0239 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location24857997-24891958 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24876344 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 72 (L72Q)
Ref Sequence ENSEMBL: ENSMUSP00000144011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031689] [ENSMUST00000200968]
Predicted Effect probably damaging
Transcript: ENSMUST00000031689
AA Change: L72Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031689
Gene: ENSMUSG00000029678
AA Change: L72Q

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 42 373 2.6e-142 PFAM
Blast:EGF 375 438 3e-14 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000200968
AA Change: L72Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144011
Gene: ENSMUSG00000029678
AA Change: L72Q

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 42 373 2.6e-142 PFAM
Blast:EGF 375 438 3e-14 BLAST
Meta Mutation Damage Score 0.022 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.9%
Validation Efficiency 100% (3/3)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hyaluronidase degrades hyaluronic acid, a major structural proteoglycan found in extracellular matrices and basement membranes. Six members of the hyaluronidase family are clustered into two tightly linked groups on chromosome 3p21.3 and 7q31.3. This gene was previously referred to as HYAL1 and HYA1 and has since been assigned the official symbol SPAM1; another family member on chromosome 3p21.3 has been assigned HYAL1. This gene encodes a GPI-anchored enzyme located on the human sperm surface and inner acrosomal membrane. This multifunctional protein is a hyaluronidase that enables sperm to penetrate through the hyaluronic acid-rich cumulus cell layer surrounding the oocyte, a receptor that plays a role in hyaluronic acid induced cell signaling, and a receptor that is involved in sperm-zona pellucida adhesion. Abnormal expression of this gene in tumors has implicated this protein in degradation of basement membranes leading to tumor invasion and metastasis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Reproduction is normal in mice with null mutations at this marker. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik TTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCC 3: 138,065,834 probably benign Het
Adra1d C A 2: 131,546,214 V474F probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Ash1l A G 3: 89,067,222 D2618G possibly damaging Het
Atp6v1c2 C A 12: 17,294,675 probably null Het
Cacna1d A G 14: 30,123,496 V572A probably benign Het
Camta1 A G 4: 151,143,730 W882R probably damaging Het
Cd72 A G 4: 43,453,163 V91A probably benign Het
Cdh12 T C 15: 21,586,407 W771R probably damaging Het
Cdx2 G T 5: 147,303,287 T193K probably damaging Het
Cfap70 A C 14: 20,448,605 S5A probably benign Het
Chmp7 A G 14: 69,720,997 V241A probably damaging Het
D3Ertd751e A G 3: 41,753,878 Y150C probably damaging Het
Depdc5 T C 5: 32,943,240 S832P probably damaging Het
Dnhd1 A G 7: 105,721,531 S4673G probably benign Het
Dock4 G T 12: 40,737,540 S818I probably damaging Het
Dysf C T 6: 84,064,479 Q156* probably null Het
Espnl T C 1: 91,322,287 V52A probably damaging Het
Flcn T C 11: 59,801,076 N249S probably benign Het
Gemin6 C A 17: 80,225,710 A24D probably damaging Het
Gm5773 A G 3: 93,774,032 H337R probably benign Het
Gm9733 A G 3: 15,296,601 L163P probably damaging Het
Hal T C 10: 93,503,482 S478P possibly damaging Het
Hectd1 T A 12: 51,769,318 M1324L possibly damaging Het
Ift140 C A 17: 25,045,523 C557* probably null Het
Ikbkap C A 4: 56,784,596 V466L probably benign Het
Kbtbd3 G T 9: 4,330,144 V173L possibly damaging Het
Kif14 A G 1: 136,527,393 E1551G probably damaging Het
Krt17 G A 11: 100,260,878 R30* probably null Het
Lamb3 A T 1: 193,321,053 D100V probably damaging Het
Map2 A G 1: 66,416,106 D1385G probably damaging Het
Mettl25 C T 10: 105,826,525 V195I probably damaging Het
Myh8 A G 11: 67,301,692 T1466A probably benign Het
Myo3b T A 2: 70,105,425 C61S probably benign Het
Nacc2 T G 2: 26,062,261 N361T probably damaging Het
Nf1 A T 11: 79,418,574 K438M possibly damaging Het
Nipal4 A G 11: 46,150,441 V309A possibly damaging Het
Nomo1 T C 7: 46,079,594 probably null Het
Nubp2 T C 17: 24,884,471 E144G probably damaging Het
Nwd2 A T 5: 63,800,124 I266F probably benign Het
Olfr1126 T C 2: 87,458,037 F291L probably benign Het
Olfr593 G A 7: 103,212,726 V289M possibly damaging Het
Olfr694 A G 7: 106,689,255 Y159H probably benign Het
Orc1 T C 4: 108,595,646 probably null Het
Otogl T A 10: 107,806,696 N1291I probably damaging Het
Pah C T 10: 87,567,281 P173S possibly damaging Het
Pga5 A G 19: 10,669,453 Y305H probably damaging Het
Plekha4 A G 7: 45,532,358 H62R probably damaging Het
Plxnd1 G T 6: 115,968,793 D906E probably benign Het
Ppfia4 T C 1: 134,329,189 E98G possibly damaging Het
Ptk2 A T 15: 73,343,283 probably null Het
Raet1e C A 10: 22,180,862 H112Q possibly damaging Het
Scai T A 2: 39,075,042 I597F probably benign Het
Slc35c2 C T 2: 165,280,837 G176S probably damaging Het
Slc35f4 A T 14: 49,304,256 I347N possibly damaging Het
Slc52a3 T C 2: 152,008,156 *461Q probably null Het
Slc6a1 G A 6: 114,302,800 V142I probably benign Het
Tbc1d31 C A 15: 57,940,753 T388N probably benign Het
Tmem63c T C 12: 87,075,639 W404R probably damaging Het
Tmem79 A G 3: 88,333,321 S107P probably benign Het
Trip11 C T 12: 101,884,728 E741K probably damaging Het
Trpm5 G T 7: 143,082,958 T414N probably damaging Het
Tsnaxip1 T A 8: 105,844,488 I660N possibly damaging Het
Ube2q2 T C 9: 55,163,007 S78P probably damaging Het
Vac14 A T 8: 110,635,375 probably null Het
Vps51 G T 19: 6,071,437 S185* probably null Het
Zfp11 C T 5: 129,658,238 G53E possibly damaging Het
Zfp532 A T 18: 65,682,985 I810F possibly damaging Het
Zfp599 C T 9: 22,249,759 C370Y probably damaging Het
Other mutations in Hyal5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Hyal5 APN 6 24876481 missense possibly damaging 0.92
IGL01407:Hyal5 APN 6 24876407 missense probably benign 0.08
IGL01799:Hyal5 APN 6 24891337 missense probably benign 0.09
IGL02070:Hyal5 APN 6 24876962 missense probably damaging 1.00
IGL02087:Hyal5 APN 6 24876725 missense probably damaging 1.00
IGL02188:Hyal5 APN 6 24877036 missense probably damaging 1.00
IGL02321:Hyal5 APN 6 24891615 missense probably benign 0.01
IGL02975:Hyal5 APN 6 24891452 missense probably benign 0.41
IGL03299:Hyal5 APN 6 24877882 missense probably damaging 1.00
R0239:Hyal5 UTSW 6 24876344 missense probably damaging 1.00
R0499:Hyal5 UTSW 6 24877921 missense probably damaging 1.00
R1491:Hyal5 UTSW 6 24877903 missense probably benign 0.00
R1575:Hyal5 UTSW 6 24876793 missense probably damaging 1.00
R1967:Hyal5 UTSW 6 24876194 missense possibly damaging 0.68
R2182:Hyal5 UTSW 6 24877880 missense probably damaging 1.00
R3801:Hyal5 UTSW 6 24876524 missense probably benign 0.44
R3877:Hyal5 UTSW 6 24876631 missense probably damaging 1.00
R4642:Hyal5 UTSW 6 24876622 missense probably benign 0.01
R4826:Hyal5 UTSW 6 24891576 missense possibly damaging 0.82
R5058:Hyal5 UTSW 6 24891485 missense probably damaging 1.00
R5161:Hyal5 UTSW 6 24891603 missense probably benign 0.00
R5249:Hyal5 UTSW 6 24876649 nonsense probably null
R5459:Hyal5 UTSW 6 24891251 missense probably damaging 0.98
R5685:Hyal5 UTSW 6 24876692 missense probably benign 0.39
R5741:Hyal5 UTSW 6 24876495 missense probably damaging 1.00
R5849:Hyal5 UTSW 6 24891556 missense probably benign 0.00
R6156:Hyal5 UTSW 6 24891438 missense possibly damaging 0.92
R6351:Hyal5 UTSW 6 24891709 unclassified probably null
R6573:Hyal5 UTSW 6 24891552 missense probably damaging 0.96
R6949:Hyal5 UTSW 6 24876304 missense probably benign 0.00
R6966:Hyal5 UTSW 6 24891292 missense probably damaging 1.00
X0061:Hyal5 UTSW 6 24876973 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GTGCCTGTAAACAGGGTTGAGGAC -3'
(R):5'- GCCGCCATTCTTCCCAATCAATGAC -3'

Sequencing Primer
(F):5'- GGACTTAGTAATGCTTCCAACCTG -3'
(R):5'- AGGCCCACATTGTCTATTGG -3'
Posted On2013-05-09