Incidental Mutation 'R0239:Plxnd1'
ID37196
Institutional Source Beutler Lab
Gene Symbol Plxnd1
Ensembl Gene ENSMUSG00000030123
Gene Nameplexin D1
Synonymsb2b553Clo, 6230425C21Rik, b2b1863Clo
MMRRC Submission 038477-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0239 (G1)
Quality Score218
Status Not validated
Chromosome6
Chromosomal Location115954811-115995005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 115968793 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 906 (D906E)
Ref Sequence ENSEMBL: ENSMUSP00000015511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015511]
Predicted Effect probably benign
Transcript: ENSMUST00000015511
AA Change: D906E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123
AA Change: D906E

DomainStartEndE-ValueType
signal peptide 1 48 N/A INTRINSIC
Sema 61 531 6.52e-90 SMART
PSI 550 603 6.06e-12 SMART
PSI 703 755 1.06e-2 SMART
Blast:PSI 850 891 9e-20 BLAST
IPT 892 981 4.43e-20 SMART
IPT 982 1068 6.61e-19 SMART
IPT 1070 1149 6.13e-14 SMART
transmembrane domain 1271 1293 N/A INTRINSIC
Pfam:Plexin_cytopl 1345 1888 5e-238 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000131590
AA Change: D48E
SMART Domains Protein: ENSMUSP00000115650
Gene: ENSMUSG00000030123
AA Change: D48E

DomainStartEndE-ValueType
Blast:PSI 2 34 1e-13 BLAST
IPT 35 124 4.43e-20 SMART
Blast:IPT 125 177 3e-30 BLAST
Pfam:TIG 180 233 4.6e-6 PFAM
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.9%
Validation Efficiency 100% (3/3)
MGI Phenotype PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik TTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCC 3: 138,065,834 probably benign Het
Adra1d C A 2: 131,546,214 V474F probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Ash1l A G 3: 89,067,222 D2618G possibly damaging Het
Atp6v1c2 C A 12: 17,294,675 probably null Het
Cacna1d A G 14: 30,123,496 V572A probably benign Het
Camta1 A G 4: 151,143,730 W882R probably damaging Het
Cd72 A G 4: 43,453,163 V91A probably benign Het
Cdh12 T C 15: 21,586,407 W771R probably damaging Het
Cdx2 G T 5: 147,303,287 T193K probably damaging Het
Cfap70 A C 14: 20,448,605 S5A probably benign Het
Chmp7 A G 14: 69,720,997 V241A probably damaging Het
D3Ertd751e A G 3: 41,753,878 Y150C probably damaging Het
Depdc5 T C 5: 32,943,240 S832P probably damaging Het
Dnhd1 A G 7: 105,721,531 S4673G probably benign Het
Dock4 G T 12: 40,737,540 S818I probably damaging Het
Dysf C T 6: 84,064,479 Q156* probably null Het
Espnl T C 1: 91,322,287 V52A probably damaging Het
Flcn T C 11: 59,801,076 N249S probably benign Het
Gemin6 C A 17: 80,225,710 A24D probably damaging Het
Gm5773 A G 3: 93,774,032 H337R probably benign Het
Gm9733 A G 3: 15,296,601 L163P probably damaging Het
Hal T C 10: 93,503,482 S478P possibly damaging Het
Hectd1 T A 12: 51,769,318 M1324L possibly damaging Het
Hyal5 T A 6: 24,876,344 L72Q probably damaging Het
Ift140 C A 17: 25,045,523 C557* probably null Het
Ikbkap C A 4: 56,784,596 V466L probably benign Het
Kbtbd3 G T 9: 4,330,144 V173L possibly damaging Het
Kif14 A G 1: 136,527,393 E1551G probably damaging Het
Krt17 G A 11: 100,260,878 R30* probably null Het
Lamb3 A T 1: 193,321,053 D100V probably damaging Het
Map2 A G 1: 66,416,106 D1385G probably damaging Het
Mettl25 C T 10: 105,826,525 V195I probably damaging Het
Myh8 A G 11: 67,301,692 T1466A probably benign Het
Myo3b T A 2: 70,105,425 C61S probably benign Het
Nacc2 T G 2: 26,062,261 N361T probably damaging Het
Nf1 A T 11: 79,418,574 K438M possibly damaging Het
Nipal4 A G 11: 46,150,441 V309A possibly damaging Het
Nomo1 T C 7: 46,079,594 probably null Het
Nubp2 T C 17: 24,884,471 E144G probably damaging Het
Nwd2 A T 5: 63,800,124 I266F probably benign Het
Olfr1126 T C 2: 87,458,037 F291L probably benign Het
Olfr593 G A 7: 103,212,726 V289M possibly damaging Het
Olfr694 A G 7: 106,689,255 Y159H probably benign Het
Orc1 T C 4: 108,595,646 probably null Het
Otogl T A 10: 107,806,696 N1291I probably damaging Het
Pah C T 10: 87,567,281 P173S possibly damaging Het
Pga5 A G 19: 10,669,453 Y305H probably damaging Het
Plekha4 A G 7: 45,532,358 H62R probably damaging Het
Ppfia4 T C 1: 134,329,189 E98G possibly damaging Het
Ptk2 A T 15: 73,343,283 probably null Het
Raet1e C A 10: 22,180,862 H112Q possibly damaging Het
Scai T A 2: 39,075,042 I597F probably benign Het
Slc35c2 C T 2: 165,280,837 G176S probably damaging Het
Slc35f4 A T 14: 49,304,256 I347N possibly damaging Het
Slc52a3 T C 2: 152,008,156 *461Q probably null Het
Slc6a1 G A 6: 114,302,800 V142I probably benign Het
Tbc1d31 C A 15: 57,940,753 T388N probably benign Het
Tmem63c T C 12: 87,075,639 W404R probably damaging Het
Tmem79 A G 3: 88,333,321 S107P probably benign Het
Trip11 C T 12: 101,884,728 E741K probably damaging Het
Trpm5 G T 7: 143,082,958 T414N probably damaging Het
Tsnaxip1 T A 8: 105,844,488 I660N possibly damaging Het
Ube2q2 T C 9: 55,163,007 S78P probably damaging Het
Vac14 A T 8: 110,635,375 probably null Het
Vps51 G T 19: 6,071,437 S185* probably null Het
Zfp11 C T 5: 129,658,238 G53E possibly damaging Het
Zfp532 A T 18: 65,682,985 I810F possibly damaging Het
Zfp599 C T 9: 22,249,759 C370Y probably damaging Het
Other mutations in Plxnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Plxnd1 APN 6 115967972 missense possibly damaging 0.51
IGL01099:Plxnd1 APN 6 115969945 missense probably benign
IGL01323:Plxnd1 APN 6 115966799 missense possibly damaging 0.81
IGL01382:Plxnd1 APN 6 115960527 missense probably damaging 1.00
IGL01786:Plxnd1 APN 6 115959935 missense probably damaging 1.00
IGL02244:Plxnd1 APN 6 115978257 missense probably benign 0.39
IGL02272:Plxnd1 APN 6 115993628 missense probably damaging 1.00
IGL02293:Plxnd1 APN 6 115963913 missense probably damaging 1.00
IGL02465:Plxnd1 APN 6 115955742 makesense probably null
IGL02873:Plxnd1 APN 6 115959976 missense probably damaging 1.00
IGL03209:Plxnd1 APN 6 115962357 missense probably damaging 1.00
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0357:Plxnd1 UTSW 6 115969460 missense probably benign 0.00
R0646:Plxnd1 UTSW 6 115958699 splice site probably benign
R0648:Plxnd1 UTSW 6 115994001 missense possibly damaging 0.86
R0718:Plxnd1 UTSW 6 115966638 missense possibly damaging 0.68
R1116:Plxnd1 UTSW 6 115967005 splice site probably null
R1292:Plxnd1 UTSW 6 115962683 unclassified probably benign
R1715:Plxnd1 UTSW 6 115968681 missense probably benign 0.02
R1760:Plxnd1 UTSW 6 115967779 missense possibly damaging 0.95
R1799:Plxnd1 UTSW 6 115994057 missense probably damaging 1.00
R1817:Plxnd1 UTSW 6 115980601 missense possibly damaging 0.83
R1848:Plxnd1 UTSW 6 115966546 missense probably damaging 1.00
R1851:Plxnd1 UTSW 6 115963914 missense probably damaging 1.00
R1864:Plxnd1 UTSW 6 115969441 unclassified probably null
R1865:Plxnd1 UTSW 6 115969441 unclassified probably null
R1875:Plxnd1 UTSW 6 115978084 splice site probably null
R1899:Plxnd1 UTSW 6 115969363 missense probably benign
R1913:Plxnd1 UTSW 6 115978017 missense possibly damaging 0.50
R1970:Plxnd1 UTSW 6 115962517 missense probably damaging 1.00
R2007:Plxnd1 UTSW 6 115967255 missense probably damaging 1.00
R2134:Plxnd1 UTSW 6 115957548 missense probably damaging 1.00
R2202:Plxnd1 UTSW 6 115962764 missense probably benign 0.45
R2230:Plxnd1 UTSW 6 115964144 missense probably damaging 1.00
R2267:Plxnd1 UTSW 6 115962743 missense probably benign 0.29
R2427:Plxnd1 UTSW 6 115967748 critical splice donor site probably null
R4108:Plxnd1 UTSW 6 115959315 missense probably damaging 1.00
R4233:Plxnd1 UTSW 6 115965953 missense probably benign 0.30
R4280:Plxnd1 UTSW 6 115956094 splice site probably benign
R4280:Plxnd1 UTSW 6 115956095 intron probably null
R4346:Plxnd1 UTSW 6 115977980 missense probably benign 0.16
R4439:Plxnd1 UTSW 6 115993976 missense probably damaging 0.99
R4572:Plxnd1 UTSW 6 115955756 missense probably damaging 1.00
R4576:Plxnd1 UTSW 6 115968044 missense probably benign 0.27
R4599:Plxnd1 UTSW 6 115994276 missense probably damaging 1.00
R4614:Plxnd1 UTSW 6 115972525 missense possibly damaging 0.83
R4700:Plxnd1 UTSW 6 115958615 missense probably damaging 1.00
R4705:Plxnd1 UTSW 6 115958620 missense probably damaging 1.00
R4806:Plxnd1 UTSW 6 115960855 missense probably damaging 1.00
R4944:Plxnd1 UTSW 6 115955765 missense probably damaging 1.00
R4977:Plxnd1 UTSW 6 115994376 missense probably damaging 1.00
R5069:Plxnd1 UTSW 6 115965901 missense probably damaging 0.98
R5155:Plxnd1 UTSW 6 115958988 critical splice donor site probably null
R5460:Plxnd1 UTSW 6 115957648 missense probably damaging 1.00
R5729:Plxnd1 UTSW 6 115965877 missense probably damaging 1.00
R5909:Plxnd1 UTSW 6 115968688 missense probably benign 0.00
R5992:Plxnd1 UTSW 6 115967787 critical splice acceptor site probably null
R6129:Plxnd1 UTSW 6 115978174 missense probably damaging 1.00
R6254:Plxnd1 UTSW 6 115977960 missense probably benign 0.01
R6273:Plxnd1 UTSW 6 115978492 missense probably damaging 1.00
R6310:Plxnd1 UTSW 6 115976736 missense possibly damaging 0.94
R6732:Plxnd1 UTSW 6 115969929 missense possibly damaging 0.94
R6857:Plxnd1 UTSW 6 115993763 missense probably benign 0.05
X0024:Plxnd1 UTSW 6 115963310 missense probably benign 0.02
X0026:Plxnd1 UTSW 6 115966784 missense possibly damaging 0.88
Z1088:Plxnd1 UTSW 6 115967510 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTGGCAATGCCTGACACTCACTC -3'
(R):5'- AGCAGCTCAGCAGCCTGATTTG -3'

Sequencing Primer
(F):5'- ACTCCTCTGAAACGGTGTATCTG -3'
(R):5'- cccacccttagcccagtc -3'
Posted On2013-05-09