Incidental Mutation 'R0239:Plekha4'
Institutional Source Beutler Lab
Gene Symbol Plekha4
Ensembl Gene ENSMUSG00000040428
Gene Namepleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4
Synonyms2410005C22Rik, PEPP1
MMRRC Submission 038477-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R0239 (G1)
Quality Score225
Status Not validated
Chromosomal Location45526330-45554229 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45532358 bp
Amino Acid Change Histidine to Arginine at position 62 (H62R)
Ref Sequence ENSEMBL: ENSMUSP00000148001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051810] [ENSMUST00000209517] [ENSMUST00000210480] [ENSMUST00000211155] [ENSMUST00000211227] [ENSMUST00000211797]
Predicted Effect probably damaging
Transcript: ENSMUST00000051810
AA Change: H62R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051468
Gene: ENSMUSG00000040428
AA Change: H62R

low complexity region 8 27 N/A INTRINSIC
PH 55 155 8.18e-19 SMART
low complexity region 162 190 N/A INTRINSIC
low complexity region 228 260 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 321 334 N/A INTRINSIC
coiled coil region 376 419 N/A INTRINSIC
low complexity region 519 535 N/A INTRINSIC
low complexity region 608 628 N/A INTRINSIC
low complexity region 649 659 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121932
AA Change: H62R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113802
Gene: ENSMUSG00000040428
AA Change: H62R

low complexity region 8 27 N/A INTRINSIC
PH 55 155 8.18e-19 SMART
low complexity region 162 190 N/A INTRINSIC
low complexity region 228 260 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 321 334 N/A INTRINSIC
coiled coil region 376 419 N/A INTRINSIC
low complexity region 519 535 N/A INTRINSIC
low complexity region 608 628 N/A INTRINSIC
low complexity region 649 659 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000209517
AA Change: H62R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000210480
Predicted Effect probably damaging
Transcript: ENSMUST00000211155
AA Change: H62R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000211227
AA Change: H62R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000211797
AA Change: T25A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.9%
Validation Efficiency 100% (3/3)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik TTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCC 3: 138,065,834 probably benign Het
Adra1d C A 2: 131,546,214 V474F probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Ash1l A G 3: 89,067,222 D2618G possibly damaging Het
Atp6v1c2 C A 12: 17,294,675 probably null Het
Cacna1d A G 14: 30,123,496 V572A probably benign Het
Camta1 A G 4: 151,143,730 W882R probably damaging Het
Cd72 A G 4: 43,453,163 V91A probably benign Het
Cdh12 T C 15: 21,586,407 W771R probably damaging Het
Cdx2 G T 5: 147,303,287 T193K probably damaging Het
Cfap70 A C 14: 20,448,605 S5A probably benign Het
Chmp7 A G 14: 69,720,997 V241A probably damaging Het
D3Ertd751e A G 3: 41,753,878 Y150C probably damaging Het
Depdc5 T C 5: 32,943,240 S832P probably damaging Het
Dnhd1 A G 7: 105,721,531 S4673G probably benign Het
Dock4 G T 12: 40,737,540 S818I probably damaging Het
Dysf C T 6: 84,064,479 Q156* probably null Het
Espnl T C 1: 91,322,287 V52A probably damaging Het
Flcn T C 11: 59,801,076 N249S probably benign Het
Gemin6 C A 17: 80,225,710 A24D probably damaging Het
Gm5773 A G 3: 93,774,032 H337R probably benign Het
Gm9733 A G 3: 15,296,601 L163P probably damaging Het
Hal T C 10: 93,503,482 S478P possibly damaging Het
Hectd1 T A 12: 51,769,318 M1324L possibly damaging Het
Hyal5 T A 6: 24,876,344 L72Q probably damaging Het
Ift140 C A 17: 25,045,523 C557* probably null Het
Ikbkap C A 4: 56,784,596 V466L probably benign Het
Kbtbd3 G T 9: 4,330,144 V173L possibly damaging Het
Kif14 A G 1: 136,527,393 E1551G probably damaging Het
Krt17 G A 11: 100,260,878 R30* probably null Het
Lamb3 A T 1: 193,321,053 D100V probably damaging Het
Map2 A G 1: 66,416,106 D1385G probably damaging Het
Mettl25 C T 10: 105,826,525 V195I probably damaging Het
Myh8 A G 11: 67,301,692 T1466A probably benign Het
Myo3b T A 2: 70,105,425 C61S probably benign Het
Nacc2 T G 2: 26,062,261 N361T probably damaging Het
Nf1 A T 11: 79,418,574 K438M possibly damaging Het
Nipal4 A G 11: 46,150,441 V309A possibly damaging Het
Nomo1 T C 7: 46,079,594 probably null Het
Nubp2 T C 17: 24,884,471 E144G probably damaging Het
Nwd2 A T 5: 63,800,124 I266F probably benign Het
Olfr1126 T C 2: 87,458,037 F291L probably benign Het
Olfr593 G A 7: 103,212,726 V289M possibly damaging Het
Olfr694 A G 7: 106,689,255 Y159H probably benign Het
Orc1 T C 4: 108,595,646 probably null Het
Otogl T A 10: 107,806,696 N1291I probably damaging Het
Pah C T 10: 87,567,281 P173S possibly damaging Het
Pga5 A G 19: 10,669,453 Y305H probably damaging Het
Plxnd1 G T 6: 115,968,793 D906E probably benign Het
Ppfia4 T C 1: 134,329,189 E98G possibly damaging Het
Ptk2 A T 15: 73,343,283 probably null Het
Raet1e C A 10: 22,180,862 H112Q possibly damaging Het
Scai T A 2: 39,075,042 I597F probably benign Het
Slc35c2 C T 2: 165,280,837 G176S probably damaging Het
Slc35f4 A T 14: 49,304,256 I347N possibly damaging Het
Slc52a3 T C 2: 152,008,156 *461Q probably null Het
Slc6a1 G A 6: 114,302,800 V142I probably benign Het
Tbc1d31 C A 15: 57,940,753 T388N probably benign Het
Tmem63c T C 12: 87,075,639 W404R probably damaging Het
Tmem79 A G 3: 88,333,321 S107P probably benign Het
Trip11 C T 12: 101,884,728 E741K probably damaging Het
Trpm5 G T 7: 143,082,958 T414N probably damaging Het
Tsnaxip1 T A 8: 105,844,488 I660N possibly damaging Het
Ube2q2 T C 9: 55,163,007 S78P probably damaging Het
Vac14 A T 8: 110,635,375 probably null Het
Vps51 G T 19: 6,071,437 S185* probably null Het
Zfp11 C T 5: 129,658,238 G53E possibly damaging Het
Zfp532 A T 18: 65,682,985 I810F possibly damaging Het
Zfp599 C T 9: 22,249,759 C370Y probably damaging Het
Other mutations in Plekha4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Plekha4 APN 7 45538235 missense probably damaging 0.97
IGL01716:Plekha4 APN 7 45534343 missense probably damaging 0.98
IGL02072:Plekha4 APN 7 45538298 missense probably benign 0.29
IGL02815:Plekha4 APN 7 45538412 missense probably damaging 1.00
IGL02939:Plekha4 APN 7 45532363 nonsense probably null
R0085:Plekha4 UTSW 7 45543949 nonsense probably null
R0239:Plekha4 UTSW 7 45532358 missense probably damaging 1.00
R1036:Plekha4 UTSW 7 45549976 splice site probably benign
R1955:Plekha4 UTSW 7 45553906 missense probably damaging 0.99
R2049:Plekha4 UTSW 7 45553798 missense probably benign 0.01
R2187:Plekha4 UTSW 7 45549274 missense probably damaging 0.99
R2888:Plekha4 UTSW 7 45538244 missense probably damaging 1.00
R5086:Plekha4 UTSW 7 45553658 missense possibly damaging 0.82
R5357:Plekha4 UTSW 7 45534771 missense probably damaging 1.00
R5604:Plekha4 UTSW 7 45549156 missense probably damaging 0.96
R5611:Plekha4 UTSW 7 45553641 missense probably benign
R6255:Plekha4 UTSW 7 45553802 utr 3 prime probably benign
R6341:Plekha4 UTSW 7 45541148 missense probably damaging 1.00
R6502:Plekha4 UTSW 7 45530576 start codon destroyed probably null 0.66
R6720:Plekha4 UTSW 7 45540886 missense possibly damaging 0.86
R6776:Plekha4 UTSW 7 45534817 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tcccttgttactttgtttgcttg -3'
Posted On2013-05-09