Incidental Mutation 'R4844:Smpdl3b'
ID372040
Institutional Source Beutler Lab
Gene Symbol Smpdl3b
Ensembl Gene ENSMUSG00000028885
Gene Namesphingomyelin phosphodiesterase, acid-like 3B
Synonyms1110054A24Rik, Asml3b
MMRRC Submission 042457-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R4844 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location132732966-132757252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132738058 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 322 (I322M)
Ref Sequence ENSEMBL: ENSMUSP00000030709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030709]
Predicted Effect probably damaging
Transcript: ENSMUST00000030709
AA Change: I322M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030709
Gene: ENSMUSG00000028885
AA Change: I322M

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Metallophos 21 281 1.9e-20 PFAM
Meta Mutation Damage Score 0.0332 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (68/70)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal but exhibit an enhanced inflammatory response in models of Toll-like receptor (TLR)-dependent peritonitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik A G 4: 35,213,565 V31A possibly damaging Het
Abcc9 T C 6: 142,689,098 T147A probably benign Het
Acvrl1 T C 15: 101,135,528 S99P probably damaging Het
Adamts3 T A 5: 89,677,816 S1055C probably damaging Het
Aftph T C 11: 20,708,667 probably benign Het
Aldh1a1 A G 19: 20,634,400 K363E probably benign Het
Astn2 A G 4: 65,644,730 V886A possibly damaging Het
Atad5 G A 11: 80,114,311 probably null Het
Ccnf G T 17: 24,230,357 Y482* probably null Het
Cfap97 A G 8: 46,169,675 D34G possibly damaging Het
Chst11 G T 10: 83,191,089 E117* probably null Het
Cobl A T 11: 12,254,740 L572Q probably benign Het
Coch G A 12: 51,602,694 G263S probably damaging Het
Coq4 T C 2: 29,796,014 I205T possibly damaging Het
Cyp3a13 A T 5: 137,917,551 I62K probably benign Het
Cyp7a1 A G 4: 6,273,655 S84P probably damaging Het
Fam45a GTCT GT 19: 60,834,997 probably null Het
G6pc3 G A 11: 102,193,231 probably null Het
Gm10576 T C 4: 101,054,510 noncoding transcript Het
Gm17511 G A 7: 127,286,282 noncoding transcript Het
Gnat2 T C 3: 108,095,515 S80P probably damaging Het
Gpaa1 C T 15: 76,332,308 probably benign Het
Gpr107 T A 2: 31,188,674 probably null Het
Hormad1 T C 3: 95,570,931 Y103H probably damaging Het
Ighv14-1 T G 12: 113,932,002 Q101P probably damaging Het
Igsf9 A G 1: 172,497,170 D885G probably benign Het
Il15ra G A 2: 11,718,271 probably benign Het
Islr2 C T 9: 58,208,234 probably benign Het
Jak3 A T 8: 71,681,655 N467I possibly damaging Het
Jarid2 T C 13: 44,913,772 V1023A probably damaging Het
Kcnn2 A T 18: 45,683,120 T333S possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kmt2c T C 5: 25,315,113 T2000A probably benign Het
Lpxn A G 19: 12,833,172 T327A probably damaging Het
Mxra8 A G 4: 155,842,694 T362A probably benign Het
Myh6 A G 14: 54,947,194 I1560T possibly damaging Het
Ndufv1 A G 19: 4,012,574 S17P probably benign Het
Nwd1 A T 8: 72,667,114 H335L probably damaging Het
Olfr38 T A 6: 42,762,460 M136K probably damaging Het
Olfr403 A G 11: 74,196,076 D191G probably damaging Het
Otop2 G A 11: 115,323,375 probably null Het
Pwwp2b C A 7: 139,255,586 S314R probably benign Het
Rfx7 C T 9: 72,593,242 Q95* probably null Het
Serpine2 A T 1: 79,799,524 L192* probably null Het
Spata31d1b C T 13: 59,718,355 R1106C possibly damaging Het
Sprr2k T G 3: 92,429,425 probably null Het
St8sia1 T A 6: 142,829,270 R194S possibly damaging Het
Sv2a T A 3: 96,188,379 V337D probably damaging Het
Tars G A 15: 11,385,195 R637W possibly damaging Het
Tcp11l2 G T 10: 84,613,691 V507L probably benign Het
Tpr T C 1: 150,445,879 Y2262H possibly damaging Het
Vars A G 17: 35,011,612 E529G probably damaging Het
Vash2 C T 1: 190,978,494 probably benign Het
Vmn1r194 T C 13: 22,245,053 V280A probably benign Het
Vti1a A G 19: 55,391,865 T142A probably damaging Het
Zfp111 C T 7: 24,199,376 C270Y probably damaging Het
Zfp518a T A 19: 40,914,896 Y1090N probably damaging Het
Zfp616 A T 11: 74,084,399 Y498F probably benign Het
Other mutations in Smpdl3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02057:Smpdl3b APN 4 132733713 missense probably benign 0.11
IGL03166:Smpdl3b APN 4 132741531 missense probably benign 0.00
R0321:Smpdl3b UTSW 4 132741444 missense probably damaging 0.99
R0450:Smpdl3b UTSW 4 132745138 missense probably damaging 1.00
R0510:Smpdl3b UTSW 4 132745138 missense probably damaging 1.00
R1462:Smpdl3b UTSW 4 132746614 missense probably damaging 1.00
R1462:Smpdl3b UTSW 4 132746614 missense probably damaging 1.00
R4725:Smpdl3b UTSW 4 132745178 missense probably damaging 0.97
R6290:Smpdl3b UTSW 4 132738275 missense possibly damaging 0.67
R6992:Smpdl3b UTSW 4 132745141 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCAAGATTCCCTTCCACGG -3'
(R):5'- CTGAGGGAACTGGCCACCT -3'

Sequencing Primer
(F):5'- CACAGAGGTGTATTTAAGCAGCTCC -3'
(R):5'- CACCTGCCAGCCTCTTC -3'
Posted On2016-03-01