Incidental Mutation 'R4845:Mastl'
ID372087
Institutional Source Beutler Lab
Gene Symbol Mastl
Ensembl Gene ENSMUSG00000026779
Gene Namemicrotubule associated serine/threonine kinase-like
Synonyms2700091H24Rik, THC2
MMRRC Submission 042458-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4845 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location23115606-23156024 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23139998 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 239 (S239P)
Ref Sequence ENSEMBL: ENSMUSP00000028119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028119]
Predicted Effect probably benign
Transcript: ENSMUST00000028119
AA Change: S239P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000028119
Gene: ENSMUSG00000026779
AA Change: S239P

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:Pkinase_Tyr 34 194 2.6e-24 PFAM
Pfam:Pkinase 34 200 2.3e-39 PFAM
low complexity region 297 313 N/A INTRINSIC
Pfam:Pkinase 710 821 6.4e-19 PFAM
Pfam:Pkinase_Tyr 714 818 5.1e-6 PFAM
S_TK_X 822 864 2.01e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136207
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated serine/threonine kinase. Mutations at this locus have been associated with autosomal dominant thrombocytopenia, also known as thrombocytopenia-2. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality and mitotic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik G T 19: 28,927,748 D305E probably benign Het
Abcg1 C T 17: 31,114,083 S600F possibly damaging Het
Arhgap21 T A 2: 20,881,187 N393I probably damaging Het
Atp5j T A 16: 84,831,477 I6F possibly damaging Het
B4galt6 A G 18: 20,688,460 L337S probably benign Het
C8b G T 4: 104,791,812 V308F possibly damaging Het
Cables1 A G 18: 11,944,488 R558G probably damaging Het
Chmp2b T A 16: 65,550,976 Q38L probably damaging Het
Clca3b A T 3: 144,825,270 I773K probably benign Het
Cnmd T C 14: 79,662,008 T2A probably benign Het
Crb1 C T 1: 139,243,034 D812N probably benign Het
Dnah7c T A 1: 46,793,532 D3901E probably damaging Het
Dst T C 1: 34,193,127 V3445A probably benign Het
Epn1 T A 7: 5,093,909 I230N possibly damaging Het
Exoc6b G T 6: 84,835,137 D627E probably benign Het
Exosc1 T C 19: 41,931,358 K74E possibly damaging Het
Extl3 T C 14: 65,077,575 T53A probably benign Het
Fam227a C T 15: 79,649,711 R17H probably damaging Het
Faxc G T 4: 21,993,358 W334L probably damaging Het
Gabrr3 T C 16: 59,426,470 I94T probably damaging Het
Ifi203 A T 1: 173,927,029 M298K probably benign Het
Igkv4-78 A T 6: 69,060,223 M1K probably null Het
Iqcm G T 8: 75,746,352 R273I probably damaging Het
Itga1 G T 13: 114,974,172 S961* probably null Het
Jmy T A 13: 93,439,738 M886L possibly damaging Het
Lrp2 T C 2: 69,509,241 T1109A possibly damaging Het
Mettl14 T A 3: 123,371,355 E112V probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Musk A G 4: 58,296,679 D93G probably damaging Het
Myoc C T 1: 162,647,465 T195M possibly damaging Het
Ncapg2 A G 12: 116,440,588 D893G probably damaging Het
Nrap C T 19: 56,351,470 V908M probably benign Het
Olfr1009 T A 2: 85,721,492 L29* probably null Het
Olfr1252 T C 2: 89,721,776 I112V probably benign Het
Olfr669 T C 7: 104,939,363 V279A possibly damaging Het
Orc4 T C 2: 48,909,466 N333S probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhb8 G A 18: 37,356,718 G483D probably benign Het
Pclo A T 5: 14,679,118 probably benign Het
Ppm1k A T 6: 57,522,768 Y174* probably null Het
Ptprq A T 10: 107,653,532 S911T probably benign Het
Rp1 C A 1: 4,349,228 A554S probably benign Het
Sema3f T C 9: 107,685,501 Y427C probably damaging Het
Slc12a1 A T 2: 125,188,226 I573F probably damaging Het
Slc17a1 A T 13: 23,876,618 Y201F probably damaging Het
Slc4a7 A T 14: 14,733,803 H71L probably damaging Het
St13 G C 15: 81,399,585 R4G probably benign Het
Tab1 C T 15: 80,152,763 R217W probably damaging Het
Taf6 T A 5: 138,182,647 Y224F possibly damaging Het
Tmc5 C G 7: 118,642,381 F432L probably damaging Het
Trbc1 A T 6: 41,539,235 probably benign Het
Trbv21 A G 6: 41,202,945 N65S probably benign Het
Trim15 G A 17: 36,866,983 P40L probably benign Het
Txnip T C 3: 96,559,600 S197P probably benign Het
Vmn1r167 T A 7: 23,504,733 Q286L probably benign Het
Wnt9a A G 11: 59,331,241 I322V probably benign Het
Zfp879 T C 11: 50,833,845 E128G probably damaging Het
Other mutations in Mastl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Mastl APN 2 23146148 missense probably damaging 1.00
IGL02103:Mastl APN 2 23139998 missense probably benign 0.01
IGL02622:Mastl APN 2 23132845 missense probably benign 0.12
IGL02826:Mastl APN 2 23145409 missense probably damaging 1.00
IGL02896:Mastl APN 2 23131767 missense probably damaging 1.00
IGL03024:Mastl APN 2 23139919 missense probably damaging 1.00
IGL03038:Mastl APN 2 23140615 splice site probably benign
R0600:Mastl UTSW 2 23133346 missense probably benign 0.06
R0712:Mastl UTSW 2 23150993 missense probably damaging 1.00
R1168:Mastl UTSW 2 23133132 missense probably benign 0.06
R1750:Mastl UTSW 2 23146081 nonsense probably null
R1911:Mastl UTSW 2 23132680 nonsense probably null
R2051:Mastl UTSW 2 23132824 missense possibly damaging 0.49
R2859:Mastl UTSW 2 23139967 missense probably damaging 0.99
R3799:Mastl UTSW 2 23140492 splice site probably benign
R3840:Mastl UTSW 2 23140551 missense probably damaging 1.00
R4807:Mastl UTSW 2 23132843 missense probably benign
R4818:Mastl UTSW 2 23137026 missense probably benign 0.00
R5338:Mastl UTSW 2 23133491 missense probably benign 0.01
R5364:Mastl UTSW 2 23133653 missense probably benign 0.16
R6077:Mastl UTSW 2 23155794 missense probably damaging 0.99
R6158:Mastl UTSW 2 23132772 missense possibly damaging 0.92
R6450:Mastl UTSW 2 23120929 missense probably damaging 1.00
R6602:Mastl UTSW 2 23132677 missense probably benign 0.04
R6788:Mastl UTSW 2 23133698 missense probably benign 0.22
R6908:Mastl UTSW 2 23155976 start gained probably benign
R7058:Mastl UTSW 2 23133413 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGAGTGCTACAGACTGTCTAAAG -3'
(R):5'- CTGAAGATGAAGCTCTTAGTACTTG -3'

Sequencing Primer
(F):5'- GGTGGCTCACAACCATCTGTAATG -3'
(R):5'- CTGAGGACACTTGAACGAGTC -3'
Posted On2016-03-01