Incidental Mutation 'R0239:Raet1e'
ID37214
Institutional Source Beutler Lab
Gene Symbol Raet1e
Ensembl Gene ENSMUSG00000053219
Gene Nameretinoic acid early transcript 1E
SynonymsRae-1 epsilon
MMRRC Submission 038477-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.432) question?
Stock #R0239 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location22158569-22374139 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 22180862 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 112 (H112Q)
Ref Sequence ENSEMBL: ENSMUSP00000138022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065527] [ENSMUST00000105522] [ENSMUST00000178026] [ENSMUST00000180648] [ENSMUST00000181645]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065527
AA Change: H112Q

PolyPhen 2 Score 0.649 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000066627
Gene: ENSMUSG00000053219
AA Change: H112Q

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:MHC_I_2 31 202 1e-121 PFAM
low complexity region 209 229 N/A INTRINSIC
transmembrane domain 233 250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105522
SMART Domains Protein: ENSMUSP00000101161
Gene: ENSMUSG00000075297

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
PDB:4G59|B 29 195 2e-9 PDB
transmembrane domain 211 233 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000178026
AA Change: H112Q

PolyPhen 2 Score 0.649 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000136032
Gene: ENSMUSG00000053219
AA Change: H112Q

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:MHC_I_2 31 202 7.3e-112 PFAM
low complexity region 209 229 N/A INTRINSIC
transmembrane domain 233 250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180648
SMART Domains Protein: ENSMUSP00000137946
Gene: ENSMUSG00000053219

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:MHC_I_2 31 66 3.8e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000181645
AA Change: H112Q

PolyPhen 2 Score 0.649 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138022
Gene: ENSMUSG00000053219
AA Change: H112Q

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:MHC_I_2 31 202 1e-121 PFAM
low complexity region 209 229 N/A INTRINSIC
transmembrane domain 233 250 N/A INTRINSIC
Meta Mutation Damage Score 0.0724 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.9%
Validation Efficiency 100% (3/3)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik TTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCC 3: 138,065,834 probably benign Het
Adra1d C A 2: 131,546,214 V474F probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Ash1l A G 3: 89,067,222 D2618G possibly damaging Het
Atp6v1c2 C A 12: 17,294,675 probably null Het
Cacna1d A G 14: 30,123,496 V572A probably benign Het
Camta1 A G 4: 151,143,730 W882R probably damaging Het
Cd72 A G 4: 43,453,163 V91A probably benign Het
Cdh12 T C 15: 21,586,407 W771R probably damaging Het
Cdx2 G T 5: 147,303,287 T193K probably damaging Het
Cfap70 A C 14: 20,448,605 S5A probably benign Het
Chmp7 A G 14: 69,720,997 V241A probably damaging Het
D3Ertd751e A G 3: 41,753,878 Y150C probably damaging Het
Depdc5 T C 5: 32,943,240 S832P probably damaging Het
Dnhd1 A G 7: 105,721,531 S4673G probably benign Het
Dock4 G T 12: 40,737,540 S818I probably damaging Het
Dysf C T 6: 84,064,479 Q156* probably null Het
Espnl T C 1: 91,322,287 V52A probably damaging Het
Flcn T C 11: 59,801,076 N249S probably benign Het
Gemin6 C A 17: 80,225,710 A24D probably damaging Het
Gm5773 A G 3: 93,774,032 H337R probably benign Het
Gm9733 A G 3: 15,296,601 L163P probably damaging Het
Hal T C 10: 93,503,482 S478P possibly damaging Het
Hectd1 T A 12: 51,769,318 M1324L possibly damaging Het
Hyal5 T A 6: 24,876,344 L72Q probably damaging Het
Ift140 C A 17: 25,045,523 C557* probably null Het
Ikbkap C A 4: 56,784,596 V466L probably benign Het
Kbtbd3 G T 9: 4,330,144 V173L possibly damaging Het
Kif14 A G 1: 136,527,393 E1551G probably damaging Het
Krt17 G A 11: 100,260,878 R30* probably null Het
Lamb3 A T 1: 193,321,053 D100V probably damaging Het
Map2 A G 1: 66,416,106 D1385G probably damaging Het
Mettl25 C T 10: 105,826,525 V195I probably damaging Het
Myh8 A G 11: 67,301,692 T1466A probably benign Het
Myo3b T A 2: 70,105,425 C61S probably benign Het
Nacc2 T G 2: 26,062,261 N361T probably damaging Het
Nf1 A T 11: 79,418,574 K438M possibly damaging Het
Nipal4 A G 11: 46,150,441 V309A possibly damaging Het
Nomo1 T C 7: 46,079,594 probably null Het
Nubp2 T C 17: 24,884,471 E144G probably damaging Het
Nwd2 A T 5: 63,800,124 I266F probably benign Het
Olfr1126 T C 2: 87,458,037 F291L probably benign Het
Olfr593 G A 7: 103,212,726 V289M possibly damaging Het
Olfr694 A G 7: 106,689,255 Y159H probably benign Het
Orc1 T C 4: 108,595,646 probably null Het
Otogl T A 10: 107,806,696 N1291I probably damaging Het
Pah C T 10: 87,567,281 P173S possibly damaging Het
Pga5 A G 19: 10,669,453 Y305H probably damaging Het
Plekha4 A G 7: 45,532,358 H62R probably damaging Het
Plxnd1 G T 6: 115,968,793 D906E probably benign Het
Ppfia4 T C 1: 134,329,189 E98G possibly damaging Het
Ptk2 A T 15: 73,343,283 probably null Het
Scai T A 2: 39,075,042 I597F probably benign Het
Slc35c2 C T 2: 165,280,837 G176S probably damaging Het
Slc35f4 A T 14: 49,304,256 I347N possibly damaging Het
Slc52a3 T C 2: 152,008,156 *461Q probably null Het
Slc6a1 G A 6: 114,302,800 V142I probably benign Het
Tbc1d31 C A 15: 57,940,753 T388N probably benign Het
Tmem63c T C 12: 87,075,639 W404R probably damaging Het
Tmem79 A G 3: 88,333,321 S107P probably benign Het
Trip11 C T 12: 101,884,728 E741K probably damaging Het
Trpm5 G T 7: 143,082,958 T414N probably damaging Het
Tsnaxip1 T A 8: 105,844,488 I660N possibly damaging Het
Ube2q2 T C 9: 55,163,007 S78P probably damaging Het
Vac14 A T 8: 110,635,375 probably null Het
Vps51 G T 19: 6,071,437 S185* probably null Het
Zfp11 C T 5: 129,658,238 G53E possibly damaging Het
Zfp532 A T 18: 65,682,985 I810F possibly damaging Het
Zfp599 C T 9: 22,249,759 C370Y probably damaging Het
Other mutations in Raet1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Raet1e APN 10 22181320 missense probably damaging 1.00
IGL02406:Raet1e APN 10 22180636 missense probably damaging 1.00
IGL02484:Raet1e APN 10 22180767 missense probably benign 0.01
R0049:Raet1e UTSW 10 22180862 missense possibly damaging 0.65
R0238:Raet1e UTSW 10 22180862 missense possibly damaging 0.65
R0238:Raet1e UTSW 10 22180862 missense possibly damaging 0.65
R0639:Raet1e UTSW 10 22174375 missense probably damaging 0.99
R0885:Raet1e UTSW 10 22182087 unclassified probably benign
R3704:Raet1e UTSW 10 22180845 missense probably benign 0.20
R4764:Raet1e UTSW 10 22181332 missense probably damaging 1.00
R4799:Raet1e UTSW 10 22181300 missense probably damaging 1.00
R5566:Raet1e UTSW 10 22174405 missense probably damaging 1.00
R6034:Raet1e UTSW 10 22182091 makesense probably null
R6034:Raet1e UTSW 10 22182091 makesense probably null
R6077:Raet1e UTSW 10 22181988 missense possibly damaging 0.72
R6238:Raet1e UTSW 10 22180871 missense probably benign 0.01
R6408:Raet1e UTSW 10 22180746 missense probably benign 0.29
R6939:Raet1e UTSW 10 22174357 missense possibly damaging 0.86
Z1088:Raet1e UTSW 10 22181951 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- GGATGCAGAACTGGTGGACATCTTG -3'
(R):5'- TGGCCCTGGCTTTGCGGATAAATC -3'

Sequencing Primer
(F):5'- GGACATCTTGAACAGGGTCTTCTC -3'
(R):5'- TGGGTAACCTGCAAATCAATAAG -3'
Posted On2013-05-09