Incidental Mutation 'R4846:Fmo3'
ID372145
Institutional Source Beutler Lab
Gene Symbol Fmo3
Ensembl Gene ENSMUSG00000026691
Gene Nameflavin containing monooxygenase 3
Synonyms
MMRRC Submission 042459-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R4846 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location162953800-162984528 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 162954311 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 491 (D491G)
Ref Sequence ENSEMBL: ENSMUSP00000028010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028010]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028010
AA Change: D491G

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028010
Gene: ENSMUSG00000026691
AA Change: D491G

DomainStartEndE-ValueType
Pfam:FMO-like 2 534 7.7e-286 PFAM
Pfam:Pyr_redox_2 3 245 4.4e-15 PFAM
Pfam:Pyr_redox_3 6 220 1.1e-11 PFAM
Pfam:NAD_binding_8 7 71 3.1e-7 PFAM
Pfam:K_oxygenase 79 224 6.7e-9 PFAM
Meta Mutation Damage Score 0.216 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Flavin-containing monooxygenases (FMO) are an important class of drug-metabolizing enzymes that catalyze the NADPH-dependent oxygenation of various nitrogen-,sulfur-, and phosphorous-containing xenobiotics such as therapeutic drugs, dietary compounds, pesticides, and other foreign compounds. The human FMO gene family is composed of 5 genes and multiple pseudogenes. FMO members have distinct developmental- and tissue-specific expression patterns. The expression of this FMO3 gene, the major FMO expressed in adult liver, can vary up to 20-fold between individuals. This inter-individual variation in FMO3 expression levels is likely to have significant effects on the rate at which xenobiotics are metabolised and, therefore, is of considerable interest to the pharmaceutical industry. This transmembrane protein localizes to the endoplasmic reticulum of many tissues. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. Mutations in this gene cause the disorder trimethylaminuria (TMAu) which is characterized by the accumulation and excretion of unmetabolized trimethylamine and a distinctive body odor. In healthy individuals, trimethylamine is primarily converted to the non odorous trimethylamine N-oxide.[provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,233 D591G probably benign Het
9930012K11Rik T A 14: 70,155,943 H299L probably damaging Het
Abcb4 C T 5: 8,935,180 A687V probably benign Het
Adam20 A G 8: 40,795,011 T53A probably benign Het
Afg1l G A 10: 42,454,494 T59I probably benign Het
AI837181 A G 19: 5,426,301 Q164R probably benign Het
Anapc15 T A 7: 101,897,767 I12N probably benign Het
Ankrd55 A C 13: 112,363,454 E278D probably benign Het
Axin2 A G 11: 108,942,299 T437A probably benign Het
BC051665 T C 13: 60,784,081 D168G probably damaging Het
Btbd11 A G 10: 85,629,266 T657A probably damaging Het
Cd200 C T 16: 45,392,301 R261H probably benign Het
Clk1 G A 1: 58,421,102 S123L probably benign Het
Csrnp2 A T 15: 100,484,690 D156E probably damaging Het
Ctss C T 3: 95,545,384 Q159* probably null Het
Dip2a A G 10: 76,321,493 S93P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ephb6 G A 6: 41,616,809 R542Q probably benign Het
Galnt14 A T 17: 73,536,893 M140K probably benign Het
Ghsr T C 3: 27,371,837 V14A probably benign Het
Gm17546 C A 15: 95,829,962 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hc A G 2: 35,019,670 V866A probably benign Het
Hoxb6 G A 11: 96,299,522 G116R probably damaging Het
Hykk A G 9: 54,920,606 Y43C probably damaging Het
Jade2 T C 11: 51,821,148 T495A probably benign Het
Kansl1 A T 11: 104,342,972 V755E possibly damaging Het
Lrp2 T A 2: 69,479,113 D2814V probably damaging Het
Mbd5 T A 2: 49,256,997 N406K probably damaging Het
Met A T 6: 17,491,929 D230V probably damaging Het
Mrgprx2 A T 7: 48,482,836 V78D probably damaging Het
Mrpl20 A G 4: 155,808,536 T112A possibly damaging Het
Nek11 T A 9: 105,163,163 E566D probably damaging Het
Nostrin T C 2: 69,175,579 S235P probably damaging Het
Npas4 C A 19: 4,986,777 S453I probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Psg18 A T 7: 18,350,786 Y128* probably null Het
Ptges3l A T 11: 101,419,184 probably benign Het
Pus1 T C 5: 110,779,930 probably benign Het
Raf1 T A 6: 115,644,583 S12C possibly damaging Het
Rps6-ps2 T G 8: 88,806,578 noncoding transcript Het
Slc5a4b A G 10: 76,062,239 L547P probably damaging Het
Socs3 A G 11: 117,967,828 S135P probably benign Het
St5 C A 7: 109,556,836 E236* probably null Het
Stra6l G A 4: 45,873,682 V281M possibly damaging Het
Suco G A 1: 161,834,408 T818I possibly damaging Het
Syde1 A T 10: 78,588,897 V367D probably damaging Het
Tet3 A T 6: 83,376,883 L932* probably null Het
Trpm7 G A 2: 126,813,185 L1278F possibly damaging Het
Vmn1r168 A T 7: 23,541,065 T116S probably damaging Het
Wfdc6b A G 2: 164,617,294 Q92R possibly damaging Het
Other mutations in Fmo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Fmo3 APN 1 162964030 missense probably benign 0.15
IGL01124:Fmo3 APN 1 162958261 missense probably damaging 1.00
IGL01645:Fmo3 APN 1 162964006 missense possibly damaging 0.53
IGL01710:Fmo3 APN 1 162983043 missense probably damaging 1.00
IGL01943:Fmo3 APN 1 162967006 missense probably benign 0.01
IGL02489:Fmo3 APN 1 162954287 missense possibly damaging 0.75
IGL02503:Fmo3 APN 1 162968864 missense probably benign 0.03
IGL02743:Fmo3 APN 1 162958483 missense probably damaging 1.00
IGL02974:Fmo3 APN 1 162983050 missense probably damaging 1.00
IGL03023:Fmo3 APN 1 162958465 missense probably benign 0.00
R0554:Fmo3 UTSW 1 162954332 missense probably benign 0.03
R0629:Fmo3 UTSW 1 162958227 splice site probably benign
R1209:Fmo3 UTSW 1 162964028 missense probably benign 0.00
R1213:Fmo3 UTSW 1 162967823 missense probably damaging 1.00
R1612:Fmo3 UTSW 1 162967885 missense probably damaging 1.00
R1636:Fmo3 UTSW 1 162954425 missense probably benign
R1710:Fmo3 UTSW 1 162967787 missense possibly damaging 0.59
R1764:Fmo3 UTSW 1 162958573 missense possibly damaging 0.79
R1775:Fmo3 UTSW 1 162968725 missense possibly damaging 0.54
R1906:Fmo3 UTSW 1 162966906 missense probably damaging 1.00
R2363:Fmo3 UTSW 1 162954315 missense probably damaging 0.98
R2418:Fmo3 UTSW 1 162966958 missense probably benign
R2519:Fmo3 UTSW 1 162958305 missense probably damaging 1.00
R3940:Fmo3 UTSW 1 162963986 missense probably benign 0.01
R3977:Fmo3 UTSW 1 162958578 missense probably damaging 0.99
R4779:Fmo3 UTSW 1 162968838 missense probably damaging 1.00
R4892:Fmo3 UTSW 1 162968731 missense probably benign 0.00
R5102:Fmo3 UTSW 1 162963977 missense probably benign 0.01
R5516:Fmo3 UTSW 1 162954426 nonsense probably null
R6035:Fmo3 UTSW 1 162964036 missense probably damaging 0.97
R6035:Fmo3 UTSW 1 162964036 missense probably damaging 0.97
R7050:Fmo3 UTSW 1 162963904 missense probably damaging 0.98
R7088:Fmo3 UTSW 1 162968865 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTCTGGCAAAAGATCTTGAACAGG -3'
(R):5'- TGGATGAACTGGCCTCCTTC -3'

Sequencing Primer
(F):5'- AATAGCAAAGTTCTTGTCTGGTTG -3'
(R):5'- TTCATTGGTGCAAAGCCCAATC -3'
Posted On2016-03-01