Incidental Mutation 'R4846:Mbd5'
ID372147
Institutional Source Beutler Lab
Gene Symbol Mbd5
Ensembl Gene ENSMUSG00000036792
Gene Namemethyl-CpG binding domain protein 5
SynonymsC030040A15Rik, OTTMUSG00000012483, 9430004D19Rik
MMRRC Submission 042459-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4846 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location48949508-49325405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49256997 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 406 (N406K)
Ref Sequence ENSEMBL: ENSMUSP00000108365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047413] [ENSMUST00000112745] [ENSMUST00000112754]
Predicted Effect probably damaging
Transcript: ENSMUST00000047413
AA Change: N406K

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000036847
Gene: ENSMUSG00000036792
AA Change: N406K

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Blast:MBD 24 77 9e-11 BLAST
low complexity region 332 342 N/A INTRINSIC
low complexity region 429 443 N/A INTRINSIC
low complexity region 459 467 N/A INTRINSIC
low complexity region 499 512 N/A INTRINSIC
low complexity region 535 546 N/A INTRINSIC
low complexity region 571 613 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
low complexity region 912 932 N/A INTRINSIC
low complexity region 934 948 N/A INTRINSIC
low complexity region 992 1010 N/A INTRINSIC
low complexity region 1020 1035 N/A INTRINSIC
low complexity region 1112 1136 N/A INTRINSIC
low complexity region 1173 1184 N/A INTRINSIC
low complexity region 1206 1229 N/A INTRINSIC
low complexity region 1552 1562 N/A INTRINSIC
SCOP:d1khca_ 1615 1718 2e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112745
AA Change: N406K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108365
Gene: ENSMUSG00000036792
AA Change: N406K

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Blast:MBD 24 77 4e-11 BLAST
low complexity region 332 342 N/A INTRINSIC
low complexity region 429 443 N/A INTRINSIC
low complexity region 459 467 N/A INTRINSIC
low complexity region 499 512 N/A INTRINSIC
low complexity region 535 546 N/A INTRINSIC
low complexity region 571 613 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112754
AA Change: N406K

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108374
Gene: ENSMUSG00000036792
AA Change: N406K

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Blast:MBD 24 77 8e-11 BLAST
low complexity region 332 342 N/A INTRINSIC
low complexity region 429 443 N/A INTRINSIC
low complexity region 459 467 N/A INTRINSIC
low complexity region 499 512 N/A INTRINSIC
low complexity region 535 546 N/A INTRINSIC
low complexity region 571 613 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
low complexity region 912 932 N/A INTRINSIC
low complexity region 934 948 N/A INTRINSIC
low complexity region 976 999 N/A INTRINSIC
low complexity region 1322 1332 N/A INTRINSIC
SCOP:d1khca_ 1385 1488 4e-17 SMART
Predicted Effect unknown
Transcript: ENSMUST00000122841
AA Change: N145K
SMART Domains Protein: ENSMUSP00000119317
Gene: ENSMUSG00000036792
AA Change: N145K

DomainStartEndE-ValueType
low complexity region 72 82 N/A INTRINSIC
low complexity region 169 183 N/A INTRINSIC
low complexity region 199 207 N/A INTRINSIC
low complexity region 239 252 N/A INTRINSIC
low complexity region 275 286 N/A INTRINSIC
low complexity region 311 353 N/A INTRINSIC
low complexity region 439 459 N/A INTRINSIC
low complexity region 581 592 N/A INTRINSIC
low complexity region 652 672 N/A INTRINSIC
low complexity region 674 688 N/A INTRINSIC
low complexity region 732 750 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 852 876 N/A INTRINSIC
low complexity region 913 924 N/A INTRINSIC
low complexity region 946 969 N/A INTRINSIC
low complexity region 1011 1022 N/A INTRINSIC
low complexity region 1056 1064 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199257
Meta Mutation Damage Score 0.274 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the methyl-CpG-binding domain (MBD) family. The MBD consists of about 70 residues and is the minimal region required for a methyl-CpG-binding protein binding specifically to methylated DNA. In addition to the MBD domain, this protein contains a PWWP domain (Pro-Trp-Trp-Pro motif), which consists of 100-150 amino acids and is found in numerous proteins that are involved in cell division, growth and differentiation. Mutations in this gene cause mental retardation autosomal dominant type 1. Haploinsufficiency of this gene is associated with a syndrome involving microcephaly, intellectual disabilities, severe speech impairment, and seizures. Alternatively spliced transcript variants have been found, but their full-length nature is not determined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozgyous for a knock-out allele exhibit severe postnatal growth retardation leading to lethality by P22, decreased body, brain and liver weights, reduced IGF-I and GH levels, and abnormal glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,233 D591G probably benign Het
9930012K11Rik T A 14: 70,155,943 H299L probably damaging Het
Abcb4 C T 5: 8,935,180 A687V probably benign Het
Adam20 A G 8: 40,795,011 T53A probably benign Het
Afg1l G A 10: 42,454,494 T59I probably benign Het
AI837181 A G 19: 5,426,301 Q164R probably benign Het
Anapc15 T A 7: 101,897,767 I12N probably benign Het
Ankrd55 A C 13: 112,363,454 E278D probably benign Het
Axin2 A G 11: 108,942,299 T437A probably benign Het
BC051665 T C 13: 60,784,081 D168G probably damaging Het
Btbd11 A G 10: 85,629,266 T657A probably damaging Het
Cd200 C T 16: 45,392,301 R261H probably benign Het
Clk1 G A 1: 58,421,102 S123L probably benign Het
Csrnp2 A T 15: 100,484,690 D156E probably damaging Het
Ctss C T 3: 95,545,384 Q159* probably null Het
Dip2a A G 10: 76,321,493 S93P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ephb6 G A 6: 41,616,809 R542Q probably benign Het
Fmo3 T C 1: 162,954,311 D491G possibly damaging Het
Galnt14 A T 17: 73,536,893 M140K probably benign Het
Ghsr T C 3: 27,371,837 V14A probably benign Het
Gm17546 C A 15: 95,829,962 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hc A G 2: 35,019,670 V866A probably benign Het
Hoxb6 G A 11: 96,299,522 G116R probably damaging Het
Hykk A G 9: 54,920,606 Y43C probably damaging Het
Jade2 T C 11: 51,821,148 T495A probably benign Het
Kansl1 A T 11: 104,342,972 V755E possibly damaging Het
Lrp2 T A 2: 69,479,113 D2814V probably damaging Het
Met A T 6: 17,491,929 D230V probably damaging Het
Mrgprx2 A T 7: 48,482,836 V78D probably damaging Het
Mrpl20 A G 4: 155,808,536 T112A possibly damaging Het
Nek11 T A 9: 105,163,163 E566D probably damaging Het
Nostrin T C 2: 69,175,579 S235P probably damaging Het
Npas4 C A 19: 4,986,777 S453I probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Psg18 A T 7: 18,350,786 Y128* probably null Het
Ptges3l A T 11: 101,419,184 probably benign Het
Pus1 T C 5: 110,779,930 probably benign Het
Raf1 T A 6: 115,644,583 S12C possibly damaging Het
Rps6-ps2 T G 8: 88,806,578 noncoding transcript Het
Slc5a4b A G 10: 76,062,239 L547P probably damaging Het
Socs3 A G 11: 117,967,828 S135P probably benign Het
St5 C A 7: 109,556,836 E236* probably null Het
Stra6l G A 4: 45,873,682 V281M possibly damaging Het
Suco G A 1: 161,834,408 T818I possibly damaging Het
Syde1 A T 10: 78,588,897 V367D probably damaging Het
Tet3 A T 6: 83,376,883 L932* probably null Het
Trpm7 G A 2: 126,813,185 L1278F possibly damaging Het
Vmn1r168 A T 7: 23,541,065 T116S probably damaging Het
Wfdc6b A G 2: 164,617,294 Q92R possibly damaging Het
Other mutations in Mbd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01385:Mbd5 APN 2 49250221 missense possibly damaging 0.92
IGL01481:Mbd5 APN 2 49278939 missense possibly damaging 0.90
IGL01639:Mbd5 APN 2 49272308 missense probably damaging 0.98
IGL02063:Mbd5 APN 2 49274767 missense probably damaging 1.00
IGL02157:Mbd5 APN 2 49278975 missense probably benign
IGL02510:Mbd5 APN 2 49257029 missense probably benign 0.05
IGL02932:Mbd5 APN 2 49279448 missense possibly damaging 0.66
IGL02973:Mbd5 APN 2 49313709 missense probably damaging 0.99
IGL03189:Mbd5 APN 2 49257751 missense probably damaging 0.98
F5770:Mbd5 UTSW 2 49316410 missense probably damaging 0.99
R0391:Mbd5 UTSW 2 49272416 missense possibly damaging 0.90
R0427:Mbd5 UTSW 2 49279079 missense probably benign 0.27
R0544:Mbd5 UTSW 2 49257209 missense possibly damaging 0.54
R0883:Mbd5 UTSW 2 49256689 missense possibly damaging 0.94
R1072:Mbd5 UTSW 2 49257191 missense probably damaging 1.00
R1099:Mbd5 UTSW 2 49258144 missense probably benign 0.06
R1400:Mbd5 UTSW 2 49274776 critical splice donor site probably null
R1497:Mbd5 UTSW 2 49257381 missense possibly damaging 0.73
R1552:Mbd5 UTSW 2 49272934 missense probably damaging 0.99
R1675:Mbd5 UTSW 2 49256218 missense possibly damaging 0.90
R1710:Mbd5 UTSW 2 49257032 missense probably benign 0.10
R2085:Mbd5 UTSW 2 49279311 missense possibly damaging 0.90
R2252:Mbd5 UTSW 2 49257686 missense probably damaging 1.00
R2473:Mbd5 UTSW 2 49279341 missense probably benign 0.06
R3966:Mbd5 UTSW 2 49272070 missense possibly damaging 0.46
R4278:Mbd5 UTSW 2 49272293 missense probably damaging 0.97
R4348:Mbd5 UTSW 2 49256327 missense probably benign
R4366:Mbd5 UTSW 2 49272966 missense probably damaging 0.99
R4428:Mbd5 UTSW 2 49279764 missense possibly damaging 0.94
R4556:Mbd5 UTSW 2 49279394 missense probably damaging 1.00
R4600:Mbd5 UTSW 2 49257197 missense probably benign 0.31
R4689:Mbd5 UTSW 2 49258279 missense possibly damaging 0.46
R4707:Mbd5 UTSW 2 49250156 missense probably damaging 0.99
R4718:Mbd5 UTSW 2 49256402 missense possibly damaging 0.66
R4773:Mbd5 UTSW 2 49274611 missense probably damaging 1.00
R5015:Mbd5 UTSW 2 49258196 missense possibly damaging 0.92
R5059:Mbd5 UTSW 2 49256455 missense probably damaging 0.96
R5268:Mbd5 UTSW 2 49272094 missense possibly damaging 0.92
R5479:Mbd5 UTSW 2 49272905 missense probably damaging 0.99
R5579:Mbd5 UTSW 2 49272814 missense possibly damaging 0.94
R5591:Mbd5 UTSW 2 49274669 missense probably damaging 1.00
R5876:Mbd5 UTSW 2 49274645 missense probably damaging 0.98
R5886:Mbd5 UTSW 2 49272452 missense probably damaging 1.00
R5973:Mbd5 UTSW 2 49272389 missense probably benign 0.23
R6935:Mbd5 UTSW 2 49279812 missense probably damaging 0.97
R7317:Mbd5 UTSW 2 49279743 missense probably benign
R7366:Mbd5 UTSW 2 49274568 missense probably benign
R7385:Mbd5 UTSW 2 49272449 missense probably benign 0.01
R7402:Mbd5 UTSW 2 49257554 missense probably damaging 1.00
R7462:Mbd5 UTSW 2 49257880 missense possibly damaging 0.52
V7583:Mbd5 UTSW 2 49316410 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACCACGAGCAATGTTCCAC -3'
(R):5'- TGTGGAAGATGAGCGTGATC -3'

Sequencing Primer
(F):5'- CTTGTGCTCTTCAGAAAAAGCC -3'
(R):5'- AAGATGAGCGTGATCTTTGGG -3'
Posted On2016-03-01