Incidental Mutation 'R4846:Ghsr'
ID372152
Institutional Source Beutler Lab
Gene Symbol Ghsr
Ensembl Gene ENSMUSG00000051136
Gene Namegrowth hormone secretagogue receptor
SynonymsC530020I22Rik
MMRRC Submission 042459-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4846 (G1)
Quality Score147
Status Validated
Chromosome3
Chromosomal Location27371351-27378010 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27371837 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 14 (V14A)
Ref Sequence ENSEMBL: ENSMUSP00000061153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057186]
Predicted Effect probably benign
Transcript: ENSMUST00000057186
AA Change: V14A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000061153
Gene: ENSMUSG00000051136
AA Change: V14A

DomainStartEndE-ValueType
low complexity region 33 43 N/A INTRINSIC
Pfam:7TM_GPCR_Srw 47 339 5.8e-12 PFAM
Pfam:7TM_GPCR_Srsx 53 336 9.4e-8 PFAM
Pfam:7tm_1 59 321 7.9e-51 PFAM
Pfam:7TM_GPCR_Srv 61 338 4.8e-9 PFAM
Meta Mutation Damage Score 0.1268 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor family. The encoded protein may play a role in energy homeostasis and regulation of body weight. Two identified transcript variants are expressed in several tissues and are evolutionary conserved in fish and swine. One transcript, 1a, excises an intron and encodes the functional protein; this protein is the receptor for the Ghrelin ligand and defines a neuroendocrine pathway for growth hormone release. The second transcript (1b) retains the intron and does not function as a receptor for Ghrelin; however, it may function to attenuate activity of isoform 1a. Mutations in this gene are associated with autosomal idiopathic short stature.[provided by RefSeq, Apr 2010]
PHENOTYPE: Homeostasis is disrupted by inactivation of this gene, namely growth hormone release and appetite stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,233 D591G probably benign Het
9930012K11Rik T A 14: 70,155,943 H299L probably damaging Het
Abcb4 C T 5: 8,935,180 A687V probably benign Het
Adam20 A G 8: 40,795,011 T53A probably benign Het
Afg1l G A 10: 42,454,494 T59I probably benign Het
AI837181 A G 19: 5,426,301 Q164R probably benign Het
Anapc15 T A 7: 101,897,767 I12N probably benign Het
Ankrd55 A C 13: 112,363,454 E278D probably benign Het
Axin2 A G 11: 108,942,299 T437A probably benign Het
BC051665 T C 13: 60,784,081 D168G probably damaging Het
Btbd11 A G 10: 85,629,266 T657A probably damaging Het
Cd200 C T 16: 45,392,301 R261H probably benign Het
Clk1 G A 1: 58,421,102 S123L probably benign Het
Csrnp2 A T 15: 100,484,690 D156E probably damaging Het
Ctss C T 3: 95,545,384 Q159* probably null Het
Dip2a A G 10: 76,321,493 S93P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ephb6 G A 6: 41,616,809 R542Q probably benign Het
Fmo3 T C 1: 162,954,311 D491G possibly damaging Het
Galnt14 A T 17: 73,536,893 M140K probably benign Het
Gm17546 C A 15: 95,829,962 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hc A G 2: 35,019,670 V866A probably benign Het
Hoxb6 G A 11: 96,299,522 G116R probably damaging Het
Hykk A G 9: 54,920,606 Y43C probably damaging Het
Jade2 T C 11: 51,821,148 T495A probably benign Het
Kansl1 A T 11: 104,342,972 V755E possibly damaging Het
Lrp2 T A 2: 69,479,113 D2814V probably damaging Het
Mbd5 T A 2: 49,256,997 N406K probably damaging Het
Met A T 6: 17,491,929 D230V probably damaging Het
Mrgprx2 A T 7: 48,482,836 V78D probably damaging Het
Mrpl20 A G 4: 155,808,536 T112A possibly damaging Het
Nek11 T A 9: 105,163,163 E566D probably damaging Het
Nostrin T C 2: 69,175,579 S235P probably damaging Het
Npas4 C A 19: 4,986,777 S453I probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Psg18 A T 7: 18,350,786 Y128* probably null Het
Ptges3l A T 11: 101,419,184 probably benign Het
Pus1 T C 5: 110,779,930 probably benign Het
Raf1 T A 6: 115,644,583 S12C possibly damaging Het
Rps6-ps2 T G 8: 88,806,578 noncoding transcript Het
Slc5a4b A G 10: 76,062,239 L547P probably damaging Het
Socs3 A G 11: 117,967,828 S135P probably benign Het
St5 C A 7: 109,556,836 E236* probably null Het
Stra6l G A 4: 45,873,682 V281M possibly damaging Het
Suco G A 1: 161,834,408 T818I possibly damaging Het
Syde1 A T 10: 78,588,897 V367D probably damaging Het
Tet3 A T 6: 83,376,883 L932* probably null Het
Trpm7 G A 2: 126,813,185 L1278F possibly damaging Het
Vmn1r168 A T 7: 23,541,065 T116S probably damaging Het
Wfdc6b A G 2: 164,617,294 Q92R possibly damaging Het
Other mutations in Ghsr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Ghsr APN 3 27374873 missense possibly damaging 0.92
IGL00435:Ghsr APN 3 27372383 missense possibly damaging 0.91
IGL01376:Ghsr APN 3 27371828 missense probably benign
IGL02444:Ghsr APN 3 27372040 missense probably benign 0.17
IGL02650:Ghsr APN 3 27374855 missense probably benign 0.29
IGL02754:Ghsr APN 3 27372496 missense probably damaging 1.00
R0571:Ghsr UTSW 3 27372016 missense probably damaging 1.00
R0825:Ghsr UTSW 3 27374627 missense probably damaging 0.99
R1036:Ghsr UTSW 3 27374720 missense probably damaging 0.98
R1462:Ghsr UTSW 3 27371876 missense probably benign 0.01
R1462:Ghsr UTSW 3 27371876 missense probably benign 0.01
R1529:Ghsr UTSW 3 27372482 missense probably damaging 1.00
R1598:Ghsr UTSW 3 27372277 missense probably benign 0.27
R4951:Ghsr UTSW 3 27372361 missense possibly damaging 0.83
R4993:Ghsr UTSW 3 27372254 missense possibly damaging 0.87
R5055:Ghsr UTSW 3 27372272 missense probably benign 0.28
R6843:Ghsr UTSW 3 27372527 missense probably benign
R6936:Ghsr UTSW 3 27372325 missense probably benign 0.02
R7068:Ghsr UTSW 3 27371837 missense probably benign 0.01
R7318:Ghsr UTSW 3 27372467 missense possibly damaging 0.91
R7510:Ghsr UTSW 3 27372374 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CATCGCTAATGTTCGCACCC -3'
(R):5'- GCCATGCTGGATAGGTAGAG -3'

Sequencing Primer
(F):5'- GCTAATGTTCGCACCCCCATTC -3'
(R):5'- CCATGCTGGATAGGTAGAGGTTGG -3'
Posted On2016-03-01