Incidental Mutation 'R4846:Pnkp'
ID372165
Institutional Source Beutler Lab
Gene Symbol Pnkp
Ensembl Gene ENSMUSG00000002963
Gene Namepolynucleotide kinase 3'- phosphatase
SynonymsPNK, 1810009G08Rik
MMRRC Submission 042459-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R4846 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44857139-44862992 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 44862403 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 113 (S113L)
Ref Sequence ENSEMBL: ENSMUSP00000144484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003044] [ENSMUST00000046575] [ENSMUST00000098478] [ENSMUST00000107876] [ENSMUST00000123015] [ENSMUST00000124168] [ENSMUST00000139003] [ENSMUST00000154968] [ENSMUST00000155050] [ENSMUST00000200892] [ENSMUST00000201882] [ENSMUST00000202646] [ENSMUST00000207363] [ENSMUST00000209018]
Predicted Effect probably damaging
Transcript: ENSMUST00000003044
AA Change: S474L

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000003044
Gene: ENSMUSG00000002963
AA Change: S474L

DomainStartEndE-ValueType
PDB:1YJM|C 1 110 4e-62 PDB
SCOP:d1lgpa_ 8 114 5e-12 SMART
Blast:FHA 31 74 1e-10 BLAST
low complexity region 116 134 N/A INTRINSIC
Pfam:PNK3P 165 327 9.3e-58 PFAM
low complexity region 350 364 N/A INTRINSIC
Pfam:AAA_33 366 488 1.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000046575
SMART Domains Protein: ENSMUSP00000035281
Gene: ENSMUSG00000038502

DomainStartEndE-ValueType
low complexity region 10 50 N/A INTRINSIC
low complexity region 64 82 N/A INTRINSIC
Pfam:Med25 89 238 1.7e-58 PFAM
Pfam:Med25 254 399 4.2e-57 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000098478
AA Change: S438L

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000096078
Gene: ENSMUSG00000002963
AA Change: S438L

DomainStartEndE-ValueType
PDB:1YJM|C 1 110 2e-62 PDB
SCOP:d1lgpa_ 8 114 5e-12 SMART
Blast:FHA 31 74 1e-10 BLAST
low complexity region 116 134 N/A INTRINSIC
Pfam:PNK3P 165 220 2.9e-16 PFAM
Pfam:PNK3P 211 291 5.3e-27 PFAM
low complexity region 314 328 N/A INTRINSIC
Pfam:AAA_33 330 452 5.6e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107876
AA Change: S474L

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103508
Gene: ENSMUSG00000002963
AA Change: S474L

DomainStartEndE-ValueType
PDB:1YJM|C 1 110 4e-62 PDB
SCOP:d1lgpa_ 8 114 5e-12 SMART
Blast:FHA 31 74 1e-10 BLAST
low complexity region 116 134 N/A INTRINSIC
Pfam:PNK3P 165 327 1.9e-57 PFAM
low complexity region 350 364 N/A INTRINSIC
Pfam:AAA_33 366 488 5.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123015
SMART Domains Protein: ENSMUSP00000143862
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
PDB:1YJ5|C 1 143 8e-72 PDB
SCOP:d1lgpa_ 8 114 7e-13 SMART
Blast:FHA 31 74 2e-10 BLAST
PDB:3U7G|A 144 165 7e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000124168
SMART Domains Protein: ENSMUSP00000144330
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
PDB:1YJM|C 1 51 3e-30 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126860
Predicted Effect probably benign
Transcript: ENSMUST00000139003
SMART Domains Protein: ENSMUSP00000143904
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
PDB:1YJM|C 1 51 3e-30 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152747
Predicted Effect probably benign
Transcript: ENSMUST00000154968
Predicted Effect probably benign
Transcript: ENSMUST00000155050
SMART Domains Protein: ENSMUSP00000144663
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
PDB:1YJM|C 1 50 9e-30 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000200892
AA Change: S95L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144163
Gene: ENSMUSG00000002963
AA Change: S95L

DomainStartEndE-ValueType
Pfam:AAA_33 18 100 3.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201882
SMART Domains Protein: ENSMUSP00000144690
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
PDB:1YJM|C 1 110 6e-63 PDB
SCOP:d1lgpa_ 8 114 3e-12 SMART
Blast:FHA 31 74 2e-10 BLAST
low complexity region 116 134 N/A INTRINSIC
Pfam:PNK3P 165 327 9.9e-55 PFAM
low complexity region 350 364 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202646
AA Change: S113L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144484
Gene: ENSMUSG00000002963
AA Change: S113L

DomainStartEndE-ValueType
Pfam:AAA_33 5 44 6.1e-7 PFAM
Pfam:AAA_33 37 117 4.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207303
Predicted Effect probably benign
Transcript: ENSMUST00000207363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207393
Predicted Effect probably benign
Transcript: ENSMUST00000207416
Predicted Effect probably benign
Transcript: ENSMUST00000208385
Predicted Effect probably benign
Transcript: ENSMUST00000208410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208655
Predicted Effect probably benign
Transcript: ENSMUST00000208666
Predicted Effect probably benign
Transcript: ENSMUST00000208682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209003
Predicted Effect probably benign
Transcript: ENSMUST00000209018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209139
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus represents a gene involved in DNA repair. In response to ionizing radiation or oxidative damage, the protein encoded by this locus catalyzes 5' phosphorylation and 3' dephosphorylation of nucleic acids. Mutations at this locus have been associated with microcephaly, seizures, and developmental delay.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes for a frame-shift allele are embryonic lethal. Homozygotes for a hypomorphic allele exhibit smaller brain (cortex and cerebellum) and defects in both single- and double-strand DNA break repair associated with increased brain apoptosis and decreased proliferation in cortical progenitors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,233 D591G probably benign Het
9930012K11Rik T A 14: 70,155,943 H299L probably damaging Het
Abcb4 C T 5: 8,935,180 A687V probably benign Het
Adam20 A G 8: 40,795,011 T53A probably benign Het
Afg1l G A 10: 42,454,494 T59I probably benign Het
AI837181 A G 19: 5,426,301 Q164R probably benign Het
Anapc15 T A 7: 101,897,767 I12N probably benign Het
Ankrd55 A C 13: 112,363,454 E278D probably benign Het
Axin2 A G 11: 108,942,299 T437A probably benign Het
BC051665 T C 13: 60,784,081 D168G probably damaging Het
Btbd11 A G 10: 85,629,266 T657A probably damaging Het
Cd200 C T 16: 45,392,301 R261H probably benign Het
Clk1 G A 1: 58,421,102 S123L probably benign Het
Csrnp2 A T 15: 100,484,690 D156E probably damaging Het
Ctss C T 3: 95,545,384 Q159* probably null Het
Dip2a A G 10: 76,321,493 S93P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ephb6 G A 6: 41,616,809 R542Q probably benign Het
Fmo3 T C 1: 162,954,311 D491G possibly damaging Het
Galnt14 A T 17: 73,536,893 M140K probably benign Het
Ghsr T C 3: 27,371,837 V14A probably benign Het
Gm17546 C A 15: 95,829,962 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hc A G 2: 35,019,670 V866A probably benign Het
Hoxb6 G A 11: 96,299,522 G116R probably damaging Het
Hykk A G 9: 54,920,606 Y43C probably damaging Het
Jade2 T C 11: 51,821,148 T495A probably benign Het
Kansl1 A T 11: 104,342,972 V755E possibly damaging Het
Lrp2 T A 2: 69,479,113 D2814V probably damaging Het
Mbd5 T A 2: 49,256,997 N406K probably damaging Het
Met A T 6: 17,491,929 D230V probably damaging Het
Mrgprx2 A T 7: 48,482,836 V78D probably damaging Het
Mrpl20 A G 4: 155,808,536 T112A possibly damaging Het
Nek11 T A 9: 105,163,163 E566D probably damaging Het
Nostrin T C 2: 69,175,579 S235P probably damaging Het
Npas4 C A 19: 4,986,777 S453I probably benign Het
Psg18 A T 7: 18,350,786 Y128* probably null Het
Ptges3l A T 11: 101,419,184 probably benign Het
Pus1 T C 5: 110,779,930 probably benign Het
Raf1 T A 6: 115,644,583 S12C possibly damaging Het
Rps6-ps2 T G 8: 88,806,578 noncoding transcript Het
Slc5a4b A G 10: 76,062,239 L547P probably damaging Het
Socs3 A G 11: 117,967,828 S135P probably benign Het
St5 C A 7: 109,556,836 E236* probably null Het
Stra6l G A 4: 45,873,682 V281M possibly damaging Het
Suco G A 1: 161,834,408 T818I possibly damaging Het
Syde1 A T 10: 78,588,897 V367D probably damaging Het
Tet3 A T 6: 83,376,883 L932* probably null Het
Trpm7 G A 2: 126,813,185 L1278F possibly damaging Het
Vmn1r168 A T 7: 23,541,065 T116S probably damaging Het
Wfdc6b A G 2: 164,617,294 Q92R possibly damaging Het
Other mutations in Pnkp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01886:Pnkp APN 7 44862207 missense probably damaging 1.00
IGL02750:Pnkp APN 7 44860187 unclassified probably benign
IGL02822:Pnkp APN 7 44862424 missense probably damaging 1.00
R1168:Pnkp UTSW 7 44862537 missense probably benign 0.00
R1437:Pnkp UTSW 7 44860402 missense possibly damaging 0.87
R1953:Pnkp UTSW 7 44862602 missense probably benign 0.02
R2879:Pnkp UTSW 7 44858678 missense probably damaging 0.99
R4329:Pnkp UTSW 7 44858594 missense probably benign 0.02
R4732:Pnkp UTSW 7 44860454 unclassified probably benign
R4842:Pnkp UTSW 7 44861646 splice site probably null
R4861:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R4861:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R4872:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R4873:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R4875:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R5068:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R5120:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R5121:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R5266:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R5267:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R6532:Pnkp UTSW 7 44857405 start codon destroyed probably null 0.99
R6974:Pnkp UTSW 7 44861038 missense probably damaging 1.00
R7289:Pnkp UTSW 7 44858690 missense probably damaging 1.00
R7326:Pnkp UTSW 7 44859734 missense probably damaging 1.00
R7394:Pnkp UTSW 7 44858678 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGACAGCTGTTTTGCCTCC -3'
(R):5'- GCTCCTGTAACCGGAATGGAATC -3'

Sequencing Primer
(F):5'- GTACATCCAATGTGCCAAAGATG -3'
(R):5'- TCCTGTAACCGGAATGGAATCTCAAG -3'
Posted On2016-03-01