Incidental Mutation 'R4846:Anapc15'
ID372167
Institutional Source Beutler Lab
Gene Symbol Anapc15
Ensembl Gene ENSMUSG00000030649
Gene Nameanaphase prompoting complex C subunit 15
Synonyms
MMRRC Submission 042459-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4846 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location101863715-101901849 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101897767 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 12 (I12N)
Ref Sequence ENSEMBL: ENSMUSP00000040286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035395] [ENSMUST00000098237] [ENSMUST00000106969] [ENSMUST00000106970] [ENSMUST00000106973] [ENSMUST00000106978] [ENSMUST00000143835] [ENSMUST00000144207] [ENSMUST00000178851] [ENSMUST00000209334] [ENSMUST00000210984]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000032884
Predicted Effect probably benign
Transcript: ENSMUST00000035395
AA Change: I12N

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000040286
Gene: ENSMUSG00000030649
AA Change: I12N

DomainStartEndE-ValueType
Pfam:ANAPC15 21 115 9.5e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098237
SMART Domains Protein: ENSMUSP00000095839
Gene: ENSMUSG00000030649

DomainStartEndE-ValueType
Pfam:ANAPC15 13 104 6.5e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106969
SMART Domains Protein: ENSMUSP00000102582
Gene: ENSMUSG00000078630

DomainStartEndE-ValueType
Pfam:Methyltransf_3 64 226 1.2e-16 PFAM
Pfam:Methyltransf_24 103 212 5.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106970
SMART Domains Protein: ENSMUSP00000102583
Gene: ENSMUSG00000078630

DomainStartEndE-ValueType
Pfam:Methyltransf_3 65 223 9.1e-19 PFAM
Pfam:Methyltransf_24 103 212 4.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106973
SMART Domains Protein: ENSMUSP00000102586
Gene: ENSMUSG00000030649

DomainStartEndE-ValueType
Pfam:ANAPC15 1 95 2.8e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106978
SMART Domains Protein: ENSMUSP00000102591
Gene: ENSMUSG00000030649

DomainStartEndE-ValueType
Pfam:ANAPC15 12 106 3.7e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131269
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137949
Predicted Effect probably benign
Transcript: ENSMUST00000143835
SMART Domains Protein: ENSMUSP00000120373
Gene: ENSMUSG00000030649

DomainStartEndE-ValueType
Pfam:ANAPC15 12 106 6.8e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144207
SMART Domains Protein: ENSMUSP00000114771
Gene: ENSMUSG00000030649

DomainStartEndE-ValueType
Pfam:ANAPC15 12 106 3.7e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146286
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150018
Predicted Effect probably benign
Transcript: ENSMUST00000178851
SMART Domains Protein: ENSMUSP00000136164
Gene: ENSMUSG00000030649

DomainStartEndE-ValueType
Pfam:ANAPC15 12 106 3.7e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209334
Predicted Effect probably benign
Transcript: ENSMUST00000210984
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,233 D591G probably benign Het
9930012K11Rik T A 14: 70,155,943 H299L probably damaging Het
Abcb4 C T 5: 8,935,180 A687V probably benign Het
Adam20 A G 8: 40,795,011 T53A probably benign Het
Afg1l G A 10: 42,454,494 T59I probably benign Het
AI837181 A G 19: 5,426,301 Q164R probably benign Het
Ankrd55 A C 13: 112,363,454 E278D probably benign Het
Axin2 A G 11: 108,942,299 T437A probably benign Het
BC051665 T C 13: 60,784,081 D168G probably damaging Het
Btbd11 A G 10: 85,629,266 T657A probably damaging Het
Cd200 C T 16: 45,392,301 R261H probably benign Het
Clk1 G A 1: 58,421,102 S123L probably benign Het
Csrnp2 A T 15: 100,484,690 D156E probably damaging Het
Ctss C T 3: 95,545,384 Q159* probably null Het
Dip2a A G 10: 76,321,493 S93P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ephb6 G A 6: 41,616,809 R542Q probably benign Het
Fmo3 T C 1: 162,954,311 D491G possibly damaging Het
Galnt14 A T 17: 73,536,893 M140K probably benign Het
Ghsr T C 3: 27,371,837 V14A probably benign Het
Gm17546 C A 15: 95,829,962 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hc A G 2: 35,019,670 V866A probably benign Het
Hoxb6 G A 11: 96,299,522 G116R probably damaging Het
Hykk A G 9: 54,920,606 Y43C probably damaging Het
Jade2 T C 11: 51,821,148 T495A probably benign Het
Kansl1 A T 11: 104,342,972 V755E possibly damaging Het
Lrp2 T A 2: 69,479,113 D2814V probably damaging Het
Mbd5 T A 2: 49,256,997 N406K probably damaging Het
Met A T 6: 17,491,929 D230V probably damaging Het
Mrgprx2 A T 7: 48,482,836 V78D probably damaging Het
Mrpl20 A G 4: 155,808,536 T112A possibly damaging Het
Nek11 T A 9: 105,163,163 E566D probably damaging Het
Nostrin T C 2: 69,175,579 S235P probably damaging Het
Npas4 C A 19: 4,986,777 S453I probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Psg18 A T 7: 18,350,786 Y128* probably null Het
Ptges3l A T 11: 101,419,184 probably benign Het
Pus1 T C 5: 110,779,930 probably benign Het
Raf1 T A 6: 115,644,583 S12C possibly damaging Het
Rps6-ps2 T G 8: 88,806,578 noncoding transcript Het
Slc5a4b A G 10: 76,062,239 L547P probably damaging Het
Socs3 A G 11: 117,967,828 S135P probably benign Het
St5 C A 7: 109,556,836 E236* probably null Het
Stra6l G A 4: 45,873,682 V281M possibly damaging Het
Suco G A 1: 161,834,408 T818I possibly damaging Het
Syde1 A T 10: 78,588,897 V367D probably damaging Het
Tet3 A T 6: 83,376,883 L932* probably null Het
Trpm7 G A 2: 126,813,185 L1278F possibly damaging Het
Vmn1r168 A T 7: 23,541,065 T116S probably damaging Het
Wfdc6b A G 2: 164,617,294 Q92R possibly damaging Het
Other mutations in Anapc15
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0426:Anapc15 UTSW 7 101898033 missense probably benign 0.10
R0513:Anapc15 UTSW 7 101898540 splice site probably benign
R4625:Anapc15 UTSW 7 101901032 unclassified probably benign
R5318:Anapc15 UTSW 7 101898603 missense probably damaging 1.00
R5334:Anapc15 UTSW 7 101898603 missense probably damaging 1.00
R5337:Anapc15 UTSW 7 101898603 missense probably damaging 1.00
R5396:Anapc15 UTSW 7 101898603 missense probably damaging 1.00
R5398:Anapc15 UTSW 7 101898603 missense probably damaging 1.00
R5399:Anapc15 UTSW 7 101898603 missense probably damaging 1.00
R5427:Anapc15 UTSW 7 101898603 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACCATTTTGCACTGGTTGG -3'
(R):5'- TCCTAAGCTGAGGGAAAGGGTC -3'

Sequencing Primer
(F):5'- CACTGGTTGGATGTGACATGAATC -3'
(R):5'- AAAGGGTCACGTGAATATGTTTTG -3'
Posted On2016-03-01