Incidental Mutation 'R4846:Hykk'
ID372171
Institutional Source Beutler Lab
Gene Symbol Hykk
Ensembl Gene ENSMUSG00000035878
Gene Namehydroxylysine kinase 1
SynonymsAgphd1, C630028N24Rik
MMRRC Submission 042459-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R4846 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location54917283-54949924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54920606 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 43 (Y43C)
Ref Sequence ENSEMBL: ENSMUSP00000039980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039742]
Predicted Effect probably damaging
Transcript: ENSMUST00000039742
AA Change: Y43C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039980
Gene: ENSMUSG00000035878
AA Change: Y43C

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:APH 36 300 2.2e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124295
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135648
Meta Mutation Damage Score 0.0336 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,233 D591G probably benign Het
9930012K11Rik T A 14: 70,155,943 H299L probably damaging Het
Abcb4 C T 5: 8,935,180 A687V probably benign Het
Adam20 A G 8: 40,795,011 T53A probably benign Het
Afg1l G A 10: 42,454,494 T59I probably benign Het
AI837181 A G 19: 5,426,301 Q164R probably benign Het
Anapc15 T A 7: 101,897,767 I12N probably benign Het
Ankrd55 A C 13: 112,363,454 E278D probably benign Het
Axin2 A G 11: 108,942,299 T437A probably benign Het
BC051665 T C 13: 60,784,081 D168G probably damaging Het
Btbd11 A G 10: 85,629,266 T657A probably damaging Het
Cd200 C T 16: 45,392,301 R261H probably benign Het
Clk1 G A 1: 58,421,102 S123L probably benign Het
Csrnp2 A T 15: 100,484,690 D156E probably damaging Het
Ctss C T 3: 95,545,384 Q159* probably null Het
Dip2a A G 10: 76,321,493 S93P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ephb6 G A 6: 41,616,809 R542Q probably benign Het
Fmo3 T C 1: 162,954,311 D491G possibly damaging Het
Galnt14 A T 17: 73,536,893 M140K probably benign Het
Ghsr T C 3: 27,371,837 V14A probably benign Het
Gm17546 C A 15: 95,829,962 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hc A G 2: 35,019,670 V866A probably benign Het
Hoxb6 G A 11: 96,299,522 G116R probably damaging Het
Jade2 T C 11: 51,821,148 T495A probably benign Het
Kansl1 A T 11: 104,342,972 V755E possibly damaging Het
Lrp2 T A 2: 69,479,113 D2814V probably damaging Het
Mbd5 T A 2: 49,256,997 N406K probably damaging Het
Met A T 6: 17,491,929 D230V probably damaging Het
Mrgprx2 A T 7: 48,482,836 V78D probably damaging Het
Mrpl20 A G 4: 155,808,536 T112A possibly damaging Het
Nek11 T A 9: 105,163,163 E566D probably damaging Het
Nostrin T C 2: 69,175,579 S235P probably damaging Het
Npas4 C A 19: 4,986,777 S453I probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Psg18 A T 7: 18,350,786 Y128* probably null Het
Ptges3l A T 11: 101,419,184 probably benign Het
Pus1 T C 5: 110,779,930 probably benign Het
Raf1 T A 6: 115,644,583 S12C possibly damaging Het
Rps6-ps2 T G 8: 88,806,578 noncoding transcript Het
Slc5a4b A G 10: 76,062,239 L547P probably damaging Het
Socs3 A G 11: 117,967,828 S135P probably benign Het
St5 C A 7: 109,556,836 E236* probably null Het
Stra6l G A 4: 45,873,682 V281M possibly damaging Het
Suco G A 1: 161,834,408 T818I possibly damaging Het
Syde1 A T 10: 78,588,897 V367D probably damaging Het
Tet3 A T 6: 83,376,883 L932* probably null Het
Trpm7 G A 2: 126,813,185 L1278F possibly damaging Het
Vmn1r168 A T 7: 23,541,065 T116S probably damaging Het
Wfdc6b A G 2: 164,617,294 Q92R possibly damaging Het
Other mutations in Hykk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02005:Hykk APN 9 54920558 missense possibly damaging 0.83
IGL02890:Hykk APN 9 54920711 missense probably benign 0.04
R0070:Hykk UTSW 9 54922348 splice site probably benign
R0734:Hykk UTSW 9 54946432 missense possibly damaging 0.93
R0830:Hykk UTSW 9 54937317 missense probably damaging 1.00
R1905:Hykk UTSW 9 54946383 missense probably benign
R2322:Hykk UTSW 9 54946134 missense probably benign 0.00
R4632:Hykk UTSW 9 54946516 missense probably benign 0.01
R5088:Hykk UTSW 9 54946479 missense probably benign 0.00
R5410:Hykk UTSW 9 54946066 missense probably damaging 1.00
R6292:Hykk UTSW 9 54920826 critical splice donor site probably null
R6416:Hykk UTSW 9 54946359 missense probably benign 0.03
R6983:Hykk UTSW 9 54946509 missense probably benign 0.00
R7261:Hykk UTSW 9 54920726 missense possibly damaging 0.53
R7276:Hykk UTSW 9 54946218 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCATTGTAATATGCCTGGCTC -3'
(R):5'- ACTGCGCTTCTACCTGTAGC -3'

Sequencing Primer
(F):5'- AGCCCGTTTTTACTGAGG -3'
(R):5'- CCCTTTAGTTCGGCATACGGAG -3'
Posted On2016-03-01