Incidental Mutation 'R4846:Syde1'
ID372176
Institutional Source Beutler Lab
Gene Symbol Syde1
Ensembl Gene ENSMUSG00000032714
Gene Namesynapse defective 1, Rho GTPase, homolog 1 (C. elegans)
Synonyms1200008N06Rik, mSYD1A
MMRRC Submission 042459-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4846 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location78584503-78591964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78588897 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 367 (V367D)
Ref Sequence ENSEMBL: ENSMUSP00000043085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040580] [ENSMUST00000105384] [ENSMUST00000218215] [ENSMUST00000218875] [ENSMUST00000218885]
Predicted Effect probably damaging
Transcript: ENSMUST00000040580
AA Change: V367D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000043085
Gene: ENSMUSG00000032714
AA Change: V367D

DomainStartEndE-ValueType
low complexity region 37 45 N/A INTRINSIC
low complexity region 56 69 N/A INTRINSIC
low complexity region 114 127 N/A INTRINSIC
low complexity region 147 160 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 321 335 N/A INTRINSIC
RhoGAP 411 601 1.49e-56 SMART
low complexity region 638 652 N/A INTRINSIC
low complexity region 681 694 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105384
SMART Domains Protein: ENSMUSP00000101023
Gene: ENSMUSG00000032763

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:TPP_enzyme_N 52 220 1.4e-53 PFAM
Pfam:TPP_enzyme_M 273 405 2.1e-16 PFAM
Pfam:TPP_enzyme_C 467 618 3.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218641
Predicted Effect probably benign
Transcript: ENSMUST00000218875
Predicted Effect probably benign
Transcript: ENSMUST00000218885
Predicted Effect probably benign
Transcript: ENSMUST00000219588
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219971
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Rho GTPase-activating protein highly expressed in placenta. The encoded protein is involved in cytoskeletal remodeling and trophoblast cell migration. Decreased expression of this gene has been associated with intrauterine growth restriction (IUGR). [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced miniature excitatory postsynaptic current freuqency and docked vesciles in CA1 synpases. Mice homozygous for another allele exhibit reduced embryos and placental weight with abnormal placenta morphology and placental vasculature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,233 D591G probably benign Het
9930012K11Rik T A 14: 70,155,943 H299L probably damaging Het
Abcb4 C T 5: 8,935,180 A687V probably benign Het
Adam20 A G 8: 40,795,011 T53A probably benign Het
Afg1l G A 10: 42,454,494 T59I probably benign Het
AI837181 A G 19: 5,426,301 Q164R probably benign Het
Anapc15 T A 7: 101,897,767 I12N probably benign Het
Ankrd55 A C 13: 112,363,454 E278D probably benign Het
Axin2 A G 11: 108,942,299 T437A probably benign Het
BC051665 T C 13: 60,784,081 D168G probably damaging Het
Btbd11 A G 10: 85,629,266 T657A probably damaging Het
Cd200 C T 16: 45,392,301 R261H probably benign Het
Clk1 G A 1: 58,421,102 S123L probably benign Het
Csrnp2 A T 15: 100,484,690 D156E probably damaging Het
Ctss C T 3: 95,545,384 Q159* probably null Het
Dip2a A G 10: 76,321,493 S93P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ephb6 G A 6: 41,616,809 R542Q probably benign Het
Fmo3 T C 1: 162,954,311 D491G possibly damaging Het
Galnt14 A T 17: 73,536,893 M140K probably benign Het
Ghsr T C 3: 27,371,837 V14A probably benign Het
Gm17546 C A 15: 95,829,962 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hc A G 2: 35,019,670 V866A probably benign Het
Hoxb6 G A 11: 96,299,522 G116R probably damaging Het
Hykk A G 9: 54,920,606 Y43C probably damaging Het
Jade2 T C 11: 51,821,148 T495A probably benign Het
Kansl1 A T 11: 104,342,972 V755E possibly damaging Het
Lrp2 T A 2: 69,479,113 D2814V probably damaging Het
Mbd5 T A 2: 49,256,997 N406K probably damaging Het
Met A T 6: 17,491,929 D230V probably damaging Het
Mrgprx2 A T 7: 48,482,836 V78D probably damaging Het
Mrpl20 A G 4: 155,808,536 T112A possibly damaging Het
Nek11 T A 9: 105,163,163 E566D probably damaging Het
Nostrin T C 2: 69,175,579 S235P probably damaging Het
Npas4 C A 19: 4,986,777 S453I probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Psg18 A T 7: 18,350,786 Y128* probably null Het
Ptges3l A T 11: 101,419,184 probably benign Het
Pus1 T C 5: 110,779,930 probably benign Het
Raf1 T A 6: 115,644,583 S12C possibly damaging Het
Rps6-ps2 T G 8: 88,806,578 noncoding transcript Het
Slc5a4b A G 10: 76,062,239 L547P probably damaging Het
Socs3 A G 11: 117,967,828 S135P probably benign Het
St5 C A 7: 109,556,836 E236* probably null Het
Stra6l G A 4: 45,873,682 V281M possibly damaging Het
Suco G A 1: 161,834,408 T818I possibly damaging Het
Tet3 A T 6: 83,376,883 L932* probably null Het
Trpm7 G A 2: 126,813,185 L1278F possibly damaging Het
Vmn1r168 A T 7: 23,541,065 T116S probably damaging Het
Wfdc6b A G 2: 164,617,294 Q92R possibly damaging Het
Other mutations in Syde1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Syde1 APN 10 78585809 missense probably damaging 1.00
IGL01285:Syde1 APN 10 78588887 missense probably damaging 1.00
IGL01529:Syde1 APN 10 78590181 missense probably benign
IGL01869:Syde1 APN 10 78588919 missense possibly damaging 0.93
IGL02098:Syde1 APN 10 78589371 missense probably damaging 1.00
IGL03187:Syde1 APN 10 78589109 missense possibly damaging 0.79
R0014:Syde1 UTSW 10 78590034 missense probably benign
R0561:Syde1 UTSW 10 78589376 missense probably damaging 1.00
R0605:Syde1 UTSW 10 78589095 unclassified probably benign
R1713:Syde1 UTSW 10 78585696 missense probably damaging 1.00
R1756:Syde1 UTSW 10 78586980 missense probably benign
R4491:Syde1 UTSW 10 78590228 missense probably benign 0.00
R5092:Syde1 UTSW 10 78589418 missense probably benign
R5287:Syde1 UTSW 10 78590037 missense probably benign
R5611:Syde1 UTSW 10 78585891 missense probably benign
R5951:Syde1 UTSW 10 78589316 missense possibly damaging 0.87
R5957:Syde1 UTSW 10 78590117 missense probably damaging 1.00
R6169:Syde1 UTSW 10 78586104 missense probably damaging 1.00
R7083:Syde1 UTSW 10 78587069 missense probably benign 0.44
R7150:Syde1 UTSW 10 78586198 nonsense probably null
R7239:Syde1 UTSW 10 78588781 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTAAGGCAGCAGGAGTG -3'
(R):5'- AGGTAAGACGTGGGACTTCC -3'

Sequencing Primer
(F):5'- AGCCAGCTCACCCGCAG -3'
(R):5'- CTTCCAGGAAGTAAGAGCAAGAAAC -3'
Posted On2016-03-01