Incidental Mutation 'R4846:Btbd11'
ID372177
Institutional Source Beutler Lab
Gene Symbol Btbd11
Ensembl Gene ENSMUSG00000020042
Gene NameBTB (POZ) domain containing 11
Synonyms6330404E16Rik
MMRRC Submission 042459-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.306) question?
Stock #R4846 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location85386814-85660292 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85629266 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 657 (T657A)
Ref Sequence ENSEMBL: ENSMUSP00000020231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020231] [ENSMUST00000105306] [ENSMUST00000105307]
Predicted Effect probably damaging
Transcript: ENSMUST00000020231
AA Change: T657A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020231
Gene: ENSMUSG00000020042
AA Change: T657A

DomainStartEndE-ValueType
low complexity region 101 109 N/A INTRINSIC
Blast:H2B 122 173 3e-9 BLAST
low complexity region 174 194 N/A INTRINSIC
Blast:H2A 195 261 6e-37 BLAST
low complexity region 262 285 N/A INTRINSIC
low complexity region 292 344 N/A INTRINSIC
Blast:H2A 350 384 9e-16 BLAST
ANK 608 637 2.74e-7 SMART
ANK 654 683 7.3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105306
AA Change: T188A

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000100943
Gene: ENSMUSG00000020042
AA Change: T188A

DomainStartEndE-ValueType
ANK 139 168 2.74e-7 SMART
ANK 185 214 7.3e-3 SMART
ANK 223 252 1.05e-3 SMART
ANK 266 296 2.21e3 SMART
BTB 459 558 5.38e-21 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105307
AA Change: T657A

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000100944
Gene: ENSMUSG00000020042
AA Change: T657A

DomainStartEndE-ValueType
low complexity region 101 109 N/A INTRINSIC
low complexity region 174 194 N/A INTRINSIC
Blast:H2A 195 261 5e-37 BLAST
low complexity region 262 285 N/A INTRINSIC
low complexity region 292 344 N/A INTRINSIC
Blast:H2A 350 384 1e-15 BLAST
ANK 608 637 2.74e-7 SMART
ANK 654 683 7.3e-3 SMART
ANK 692 721 1.05e-3 SMART
ANK 735 765 2.21e3 SMART
BTB 928 1027 5.38e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145323
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,233 D591G probably benign Het
9930012K11Rik T A 14: 70,155,943 H299L probably damaging Het
Abcb4 C T 5: 8,935,180 A687V probably benign Het
Adam20 A G 8: 40,795,011 T53A probably benign Het
Afg1l G A 10: 42,454,494 T59I probably benign Het
AI837181 A G 19: 5,426,301 Q164R probably benign Het
Anapc15 T A 7: 101,897,767 I12N probably benign Het
Ankrd55 A C 13: 112,363,454 E278D probably benign Het
Axin2 A G 11: 108,942,299 T437A probably benign Het
BC051665 T C 13: 60,784,081 D168G probably damaging Het
Cd200 C T 16: 45,392,301 R261H probably benign Het
Clk1 G A 1: 58,421,102 S123L probably benign Het
Csrnp2 A T 15: 100,484,690 D156E probably damaging Het
Ctss C T 3: 95,545,384 Q159* probably null Het
Dip2a A G 10: 76,321,493 S93P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ephb6 G A 6: 41,616,809 R542Q probably benign Het
Fmo3 T C 1: 162,954,311 D491G possibly damaging Het
Galnt14 A T 17: 73,536,893 M140K probably benign Het
Ghsr T C 3: 27,371,837 V14A probably benign Het
Gm17546 C A 15: 95,829,962 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hc A G 2: 35,019,670 V866A probably benign Het
Hoxb6 G A 11: 96,299,522 G116R probably damaging Het
Hykk A G 9: 54,920,606 Y43C probably damaging Het
Jade2 T C 11: 51,821,148 T495A probably benign Het
Kansl1 A T 11: 104,342,972 V755E possibly damaging Het
Lrp2 T A 2: 69,479,113 D2814V probably damaging Het
Mbd5 T A 2: 49,256,997 N406K probably damaging Het
Met A T 6: 17,491,929 D230V probably damaging Het
Mrgprx2 A T 7: 48,482,836 V78D probably damaging Het
Mrpl20 A G 4: 155,808,536 T112A possibly damaging Het
Nek11 T A 9: 105,163,163 E566D probably damaging Het
Nostrin T C 2: 69,175,579 S235P probably damaging Het
Npas4 C A 19: 4,986,777 S453I probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Psg18 A T 7: 18,350,786 Y128* probably null Het
Ptges3l A T 11: 101,419,184 probably benign Het
Pus1 T C 5: 110,779,930 probably benign Het
Raf1 T A 6: 115,644,583 S12C possibly damaging Het
Rps6-ps2 T G 8: 88,806,578 noncoding transcript Het
Slc5a4b A G 10: 76,062,239 L547P probably damaging Het
Socs3 A G 11: 117,967,828 S135P probably benign Het
St5 C A 7: 109,556,836 E236* probably null Het
Stra6l G A 4: 45,873,682 V281M possibly damaging Het
Suco G A 1: 161,834,408 T818I possibly damaging Het
Syde1 A T 10: 78,588,897 V367D probably damaging Het
Tet3 A T 6: 83,376,883 L932* probably null Het
Trpm7 G A 2: 126,813,185 L1278F possibly damaging Het
Vmn1r168 A T 7: 23,541,065 T116S probably damaging Het
Wfdc6b A G 2: 164,617,294 Q92R possibly damaging Het
Other mutations in Btbd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Btbd11 APN 10 85629216 missense possibly damaging 0.87
IGL01143:Btbd11 APN 10 85654471 splice site probably benign
IGL01365:Btbd11 APN 10 85633816 missense possibly damaging 0.75
IGL01409:Btbd11 APN 10 85658165 missense possibly damaging 0.88
IGL01531:Btbd11 APN 10 85629205 splice site probably benign
IGL01593:Btbd11 APN 10 85654475 splice site probably benign
IGL01751:Btbd11 APN 10 85654502 missense probably damaging 1.00
IGL01752:Btbd11 APN 10 85654502 missense probably damaging 1.00
IGL02041:Btbd11 APN 10 85387554 missense unknown
IGL02486:Btbd11 APN 10 85640555 missense probably damaging 1.00
IGL02597:Btbd11 APN 10 85633801 missense probably damaging 1.00
IGL02957:Btbd11 APN 10 85633837 missense probably damaging 1.00
IGL02957:Btbd11 APN 10 85631286 splice site probably benign
IGL02967:Btbd11 APN 10 85633782 missense probably benign 0.11
IGL02975:Btbd11 APN 10 85631343 missense probably benign 0.16
IGL03078:Btbd11 APN 10 85632163 missense probably damaging 1.00
IGL03130:Btbd11 APN 10 85388483 splice site probably null
IGL03335:Btbd11 APN 10 85658358 utr 3 prime probably benign
R0024:Btbd11 UTSW 10 85387447 missense unknown
R0599:Btbd11 UTSW 10 85658336 missense probably damaging 1.00
R0655:Btbd11 UTSW 10 85645526 missense probably damaging 1.00
R0660:Btbd11 UTSW 10 85388370 missense possibly damaging 0.65
R0664:Btbd11 UTSW 10 85388370 missense possibly damaging 0.65
R1155:Btbd11 UTSW 10 85629291 missense probably damaging 1.00
R1244:Btbd11 UTSW 10 85387363 missense unknown
R1389:Btbd11 UTSW 10 85640596 missense possibly damaging 0.76
R1418:Btbd11 UTSW 10 85645578 missense probably damaging 1.00
R1703:Btbd11 UTSW 10 85387384 missense unknown
R1957:Btbd11 UTSW 10 85633699 missense probably damaging 1.00
R2519:Btbd11 UTSW 10 85651611 missense probably damaging 1.00
R3716:Btbd11 UTSW 10 85561528 missense probably damaging 1.00
R3915:Btbd11 UTSW 10 85632270 missense probably damaging 1.00
R4738:Btbd11 UTSW 10 85627248 nonsense probably null
R4782:Btbd11 UTSW 10 85654550 missense probably damaging 1.00
R4887:Btbd11 UTSW 10 85387378 missense unknown
R4960:Btbd11 UTSW 10 85651662 missense probably benign 0.34
R5224:Btbd11 UTSW 10 85645522 small deletion probably benign
R5341:Btbd11 UTSW 10 85387372 missense unknown
R5713:Btbd11 UTSW 10 85651652 missense probably damaging 1.00
R6046:Btbd11 UTSW 10 85388083 missense unknown
R6461:Btbd11 UTSW 10 85640564 missense probably damaging 1.00
R6809:Btbd11 UTSW 10 85631376 missense probably benign 0.01
R7069:Btbd11 UTSW 10 85387656 missense unknown
R7130:Btbd11 UTSW 10 85387555 missense unknown
R7202:Btbd11 UTSW 10 85387765 missense unknown
R7275:Btbd11 UTSW 10 85654482 missense probably damaging 1.00
R7489:Btbd11 UTSW 10 85627215 missense probably damaging 1.00
X0020:Btbd11 UTSW 10 85631352 missense possibly damaging 0.86
Z1088:Btbd11 UTSW 10 85387857 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- GGGAAATCACTAGCTCCAGTC -3'
(R):5'- GCTTGGCCAAATAGATGCTTC -3'

Sequencing Primer
(F):5'- GCTCCAGTCACCCCCAAGG -3'
(R):5'- GGCCAAATAGATGCTTCAGTATAATG -3'
Posted On2016-03-01