Incidental Mutation 'R4858:Setd5'
ID372218
Institutional Source Beutler Lab
Gene Symbol Setd5
Ensembl Gene ENSMUSG00000034269
Gene NameSET domain containing 5
Synonyms2900045N06Rik
MMRRC Submission 042469-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4858 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location113077365-113153435 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 113149566 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1188 (T1188I)
Ref Sequence ENSEMBL: ENSMUSP00000108782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042889] [ENSMUST00000113155] [ENSMUST00000113157]
Predicted Effect probably damaging
Transcript: ENSMUST00000042889
AA Change: T1169I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047398
Gene: ENSMUSG00000034269
AA Change: T1169I

DomainStartEndE-ValueType
low complexity region 165 180 N/A INTRINSIC
SET 272 396 1.09e-23 SMART
low complexity region 417 429 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 476 495 N/A INTRINSIC
low complexity region 539 552 N/A INTRINSIC
low complexity region 561 572 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 635 650 N/A INTRINSIC
low complexity region 850 866 N/A INTRINSIC
low complexity region 1082 1107 N/A INTRINSIC
low complexity region 1122 1138 N/A INTRINSIC
low complexity region 1250 1259 N/A INTRINSIC
low complexity region 1283 1301 N/A INTRINSIC
low complexity region 1335 1346 N/A INTRINSIC
low complexity region 1352 1372 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113155
AA Change: T1188I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108780
Gene: ENSMUSG00000034269
AA Change: T1188I

DomainStartEndE-ValueType
low complexity region 65 76 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
SET 291 415 1.09e-23 SMART
low complexity region 436 448 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 558 571 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 619 640 N/A INTRINSIC
low complexity region 654 669 N/A INTRINSIC
low complexity region 869 885 N/A INTRINSIC
low complexity region 1101 1126 N/A INTRINSIC
low complexity region 1141 1157 N/A INTRINSIC
low complexity region 1269 1278 N/A INTRINSIC
low complexity region 1302 1320 N/A INTRINSIC
low complexity region 1354 1365 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113157
AA Change: T1188I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108782
Gene: ENSMUSG00000034269
AA Change: T1188I

DomainStartEndE-ValueType
low complexity region 65 76 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
SET 291 415 1.09e-23 SMART
low complexity region 436 448 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 558 571 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 619 640 N/A INTRINSIC
low complexity region 654 669 N/A INTRINSIC
low complexity region 869 885 N/A INTRINSIC
low complexity region 1101 1126 N/A INTRINSIC
low complexity region 1141 1157 N/A INTRINSIC
low complexity region 1269 1278 N/A INTRINSIC
low complexity region 1302 1320 N/A INTRINSIC
low complexity region 1354 1365 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142215
AA Change: T1246I
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150107
Meta Mutation Damage Score 0.208 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 94% (103/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This function of this gene has yet to be determined but mutations in this gene have been associated with autosomal dominant mental retardation-23. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T C 10: 10,349,577 Y1415C probably damaging Het
Adgrf1 T C 17: 43,303,672 S216P probably damaging Het
Ankrd12 T C 17: 66,031,433 D197G probably damaging Het
Aoc3 C A 11: 101,331,662 H198Q probably damaging Het
Aox1 C A 1: 58,104,481 H1253N probably benign Het
Arg1 T A 10: 24,922,638 E38V possibly damaging Het
Baz2b T A 2: 59,907,743 M1741L probably benign Het
Bend4 T C 5: 67,417,572 E322G probably damaging Het
Brpf1 T C 6: 113,317,678 V661A possibly damaging Het
C2cd3 A T 7: 100,454,953 T2058S probably damaging Het
Camk4 T C 18: 33,176,213 V223A probably damaging Het
Casp1 C T 9: 5,306,742 R395C probably damaging Het
Ccdc180 T G 4: 45,923,244 I1066S probably damaging Het
Ccne1 A G 7: 38,099,319 F292L probably damaging Het
Ccz1 A T 5: 144,012,810 M100K probably damaging Het
Cep128 T C 12: 91,260,162 T678A probably benign Het
Cep290 G A 10: 100,494,911 R151Q probably benign Het
Crip3 A G 17: 46,430,747 probably benign Het
Ddx60 A G 8: 62,021,314 M1479V possibly damaging Het
Defb40 T A 8: 18,975,077 I38F probably benign Het
Diexf A G 1: 193,113,764 Y686H probably damaging Het
Dnajb2 C T 1: 75,243,554 T221I possibly damaging Het
Dpcr1 G A 17: 35,637,576 T377I possibly damaging Het
Dpysl3 T C 18: 43,334,014 I279V probably damaging Het
Echs1 G A 7: 140,112,586 probably benign Het
Efl1 T A 7: 82,671,627 N89K probably damaging Het
Extl3 T C 14: 65,075,994 T580A probably benign Het
Fam171a2 C T 11: 102,440,156 G193E probably damaging Het
Fam234a A T 17: 26,216,617 D264E probably benign Het
Fbxw20 A T 9: 109,234,695 V3D possibly damaging Het
Fig4 G A 10: 41,233,590 P637L probably benign Het
Fnbp1l G A 3: 122,546,315 T496I probably benign Het
Fry T C 5: 150,401,643 V1175A possibly damaging Het
Gm5617 C T 9: 48,495,668 A34V possibly damaging Het
Gnai1 A T 5: 18,291,598 V109E probably benign Het
H2-K1 A T 17: 33,997,324 Y283N probably benign Het
Hectd2 A T 19: 36,605,282 I471F probably damaging Het
Hsdl2 T C 4: 59,612,812 probably null Het
Igkv3-1 T C 6: 70,704,044 S76P probably damaging Het
Krt15 A T 11: 100,132,071 S439R probably benign Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Lima1 G A 15: 99,819,576 T23I probably benign Het
Map4k1 C A 7: 28,988,770 H248Q probably damaging Het
Mcf2l C A 8: 13,013,972 T1004K probably damaging Het
Micall1 T A 15: 79,122,946 probably benign Het
Ms4a14 A G 19: 11,301,612 I1194T probably benign Het
Mtor T C 4: 148,454,816 *257Q probably null Het
Ncan T A 8: 70,104,055 T961S probably benign Het
Olfr1100 T G 2: 86,978,349 Y149S probably damaging Het
Olfr161 T C 16: 3,592,842 S149P probably damaging Het
Olfr311 T A 11: 58,841,207 L31H possibly damaging Het
Olfr331 T A 11: 58,501,909 I216F probably damaging Het
Olfr389 T A 11: 73,776,546 L260F probably benign Het
Olfr419 A T 1: 174,250,696 I77N probably damaging Het
Pcdhgb2 A G 18: 37,692,100 R715G probably benign Het
Pik3c3 T C 18: 30,344,078 probably null Het
Pkhd1l1 A T 15: 44,491,101 D296V probably damaging Het
Plekhh2 A G 17: 84,600,697 I1189V probably damaging Het
Psg18 A T 7: 18,353,484 L83Q possibly damaging Het
Rps6kc1 A G 1: 190,800,318 W496R probably damaging Het
Slc4a3 T C 1: 75,555,085 F899L probably damaging Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Speg G T 1: 75,421,735 R1942L probably damaging Het
Sulf2 C A 2: 166,081,604 R565L probably benign Het
Tcerg1 T C 18: 42,523,981 M176T unknown Het
Tfcp2l1 T C 1: 118,669,509 I440T possibly damaging Het
Tgm7 A T 2: 121,098,964 probably null Het
Tjp2 C A 19: 24,122,120 G433V probably damaging Het
Tldc1 T G 8: 119,772,523 T77P probably benign Het
Tmc7 C T 7: 118,543,342 G608R probably damaging Het
Tmed4 A G 11: 6,274,456 F68S possibly damaging Het
Tmem30b G A 12: 73,545,912 P143L probably damaging Het
Tnfrsf23 C T 7: 143,681,480 C49Y probably damaging Het
Tnni3k A T 3: 154,786,808 probably null Het
Trav12-2 G T 14: 53,616,693 M41I probably benign Het
Trim6 T A 7: 104,232,485 Y314* probably null Het
Ttc25 A G 11: 100,550,321 N126S probably damaging Het
Vmn2r118 A G 17: 55,592,894 V670A probably damaging Het
Zfp438 A T 18: 5,213,154 D601E probably benign Het
Zfp606 T A 7: 12,493,056 I310N possibly damaging Het
Other mutations in Setd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Setd5 APN 6 113111414 missense probably damaging 1.00
IGL02102:Setd5 APN 6 113150985 nonsense probably null
IGL02105:Setd5 APN 6 113117580 missense probably damaging 1.00
IGL02202:Setd5 APN 6 113151015 missense probably benign 0.01
IGL02221:Setd5 APN 6 113121170 splice site probably benign
IGL02382:Setd5 APN 6 113143640 missense probably benign
IGL02394:Setd5 APN 6 113110898 missense probably benign 0.00
IGL02442:Setd5 APN 6 113110380 missense possibly damaging 0.93
IGL02480:Setd5 APN 6 113143809 missense probably damaging 1.00
IGL02940:Setd5 APN 6 113114938 missense possibly damaging 0.92
R0320:Setd5 UTSW 6 113111481 missense probably damaging 1.00
R0479:Setd5 UTSW 6 113115033 missense probably damaging 1.00
R0514:Setd5 UTSW 6 113119437 nonsense probably null
R1528:Setd5 UTSW 6 113121738 missense probably damaging 0.99
R1530:Setd5 UTSW 6 113109913 missense probably damaging 1.00
R2176:Setd5 UTSW 6 113151153 missense probably benign 0.23
R2191:Setd5 UTSW 6 113111429 nonsense probably null
R2286:Setd5 UTSW 6 113119610 missense possibly damaging 0.69
R4163:Setd5 UTSW 6 113119584 missense probably benign
R4294:Setd5 UTSW 6 113111320 intron probably benign
R4300:Setd5 UTSW 6 113150162 missense probably damaging 1.00
R4342:Setd5 UTSW 6 113111320 intron probably benign
R4370:Setd5 UTSW 6 113121805 missense probably damaging 1.00
R4854:Setd5 UTSW 6 113151399 missense probably damaging 1.00
R5057:Setd5 UTSW 6 113137961 missense probably damaging 0.96
R5345:Setd5 UTSW 6 113116007 missense probably damaging 1.00
R5529:Setd5 UTSW 6 113121568 missense probably damaging 1.00
R5556:Setd5 UTSW 6 113147502 missense probably benign 0.00
R5582:Setd5 UTSW 6 113114925 missense probably damaging 1.00
R5838:Setd5 UTSW 6 113119435 missense probably benign 0.40
R5941:Setd5 UTSW 6 113128490 missense probably damaging 1.00
R6009:Setd5 UTSW 6 113110519 missense probably damaging 0.99
R6146:Setd5 UTSW 6 113121812 critical splice donor site probably null
R6394:Setd5 UTSW 6 113115544 missense probably damaging 1.00
R6694:Setd5 UTSW 6 113143708 missense probably benign
R7058:Setd5 UTSW 6 113115571 missense probably benign 0.16
R7060:Setd5 UTSW 6 113117382 missense probably damaging 1.00
R7199:Setd5 UTSW 6 113121138 missense probably benign 0.03
R7238:Setd5 UTSW 6 113121130 missense probably damaging 1.00
R7296:Setd5 UTSW 6 113147557 missense probably benign 0.21
R7438:Setd5 UTSW 6 113115082 missense possibly damaging 0.74
X0017:Setd5 UTSW 6 113150168 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ACATTGCATAGTTTGAAGCAGAGG -3'
(R):5'- CCCAAAGAGTAAGACTGAGCTG -3'

Sequencing Primer
(F):5'- GAAATGCCTTGTTCTCAGTAGGTCC -3'
(R):5'- GGTCAGAAACTAACTTACTTTATCCC -3'
Posted On2016-03-01