Incidental Mutation 'R0239:Cacna1d'
ID37230
Institutional Source Beutler Lab
Gene Symbol Cacna1d
Ensembl Gene ENSMUSG00000015968
Gene Namecalcium channel, voltage-dependent, L type, alpha 1D subunit
SynonymsC79217, Cchl1a2, Cav1.3alpha1, Cchl1a, Cacnl1a2, D-LTCC, 8430418G19Rik
MMRRC Submission 038477-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.667) question?
Stock #R0239 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location30039939-30491455 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30123496 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 572 (V572A)
Ref Sequence ENSEMBL: ENSMUSP00000153586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112249] [ENSMUST00000112250] [ENSMUST00000223803] [ENSMUST00000224198] [ENSMUST00000224395] [ENSMUST00000224785]
Predicted Effect probably benign
Transcript: ENSMUST00000112249
AA Change: V572A

PolyPhen 2 Score 0.295 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107868
Gene: ENSMUSG00000015968
AA Change: V572A

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
Pfam:Ion_trans 163 405 4.8e-59 PFAM
PDB:4DEY|B 406 502 3e-38 PDB
low complexity region 503 517 N/A INTRINSIC
Pfam:Ion_trans 557 751 5.5e-46 PFAM
low complexity region 766 781 N/A INTRINSIC
low complexity region 819 840 N/A INTRINSIC
Pfam:Ion_trans 921 1151 7.2e-51 PFAM
Pfam:Ion_trans 1239 1448 3.6e-67 PFAM
Pfam:PKD_channel 1285 1455 1.9e-9 PFAM
Blast:EFh 1469 1497 2e-9 BLAST
Ca_chan_IQ 1583 1617 5.05e-16 SMART
low complexity region 1649 1661 N/A INTRINSIC
low complexity region 1722 1728 N/A INTRINSIC
low complexity region 1830 1840 N/A INTRINSIC
low complexity region 1885 1905 N/A INTRINSIC
low complexity region 1921 1936 N/A INTRINSIC
low complexity region 2122 2133 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112250
AA Change: V594A

PolyPhen 2 Score 0.169 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107869
Gene: ENSMUSG00000015968
AA Change: V594A

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
Pfam:Ion_trans 147 439 5.6e-72 PFAM
low complexity region 473 482 N/A INTRINSIC
low complexity region 525 539 N/A INTRINSIC
Pfam:Ion_trans 544 784 2e-56 PFAM
low complexity region 788 803 N/A INTRINSIC
low complexity region 841 862 N/A INTRINSIC
Pfam:Ion_trans 907 1185 2.6e-63 PFAM
Pfam:Ion_trans 1226 1482 1.7e-70 PFAM
Pfam:PKD_channel 1306 1477 1.2e-9 PFAM
Pfam:GPHH 1484 1553 2.3e-38 PFAM
Ca_chan_IQ 1605 1639 5.05e-16 SMART
Pfam:CAC1F_C 1649 2165 1.1e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223803
AA Change: V572A

PolyPhen 2 Score 0.295 (Sensitivity: 0.91; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224073
Predicted Effect probably benign
Transcript: ENSMUST00000224198
AA Change: V592A

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000224395
Predicted Effect probably benign
Transcript: ENSMUST00000224785
AA Change: V572A

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.9%
Validation Efficiency 100% (3/3)
MGI Phenotype FUNCTION: This gene encodes a pore-forming subunit of the L-type, voltage-activated calcium channel family. These channels have been found to play a role in heart and smooth muscle contraction and in the transmission of auditory information. Homozygous knockout mice for this gene exhibit deafness and heart defects. These channels have also been linked to mitochondrial oxidative stress in a mouse model of Parkinson's disease. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes for targeted mutations exhibit small size, hypoinsulinemia, glucose intolerance, decreased number and size of pancreatic islets, deafness with degeneration of hair cells, bradycardia, and arrhythmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik TTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCC 3: 138,065,834 probably benign Het
Adra1d C A 2: 131,546,214 V474F probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Ash1l A G 3: 89,067,222 D2618G possibly damaging Het
Atp6v1c2 C A 12: 17,294,675 probably null Het
Camta1 A G 4: 151,143,730 W882R probably damaging Het
Cd72 A G 4: 43,453,163 V91A probably benign Het
Cdh12 T C 15: 21,586,407 W771R probably damaging Het
Cdx2 G T 5: 147,303,287 T193K probably damaging Het
Cfap70 A C 14: 20,448,605 S5A probably benign Het
Chmp7 A G 14: 69,720,997 V241A probably damaging Het
D3Ertd751e A G 3: 41,753,878 Y150C probably damaging Het
Depdc5 T C 5: 32,943,240 S832P probably damaging Het
Dnhd1 A G 7: 105,721,531 S4673G probably benign Het
Dock4 G T 12: 40,737,540 S818I probably damaging Het
Dysf C T 6: 84,064,479 Q156* probably null Het
Espnl T C 1: 91,322,287 V52A probably damaging Het
Flcn T C 11: 59,801,076 N249S probably benign Het
Gemin6 C A 17: 80,225,710 A24D probably damaging Het
Gm5773 A G 3: 93,774,032 H337R probably benign Het
Gm9733 A G 3: 15,296,601 L163P probably damaging Het
Hal T C 10: 93,503,482 S478P possibly damaging Het
Hectd1 T A 12: 51,769,318 M1324L possibly damaging Het
Hyal5 T A 6: 24,876,344 L72Q probably damaging Het
Ift140 C A 17: 25,045,523 C557* probably null Het
Ikbkap C A 4: 56,784,596 V466L probably benign Het
Kbtbd3 G T 9: 4,330,144 V173L possibly damaging Het
Kif14 A G 1: 136,527,393 E1551G probably damaging Het
Krt17 G A 11: 100,260,878 R30* probably null Het
Lamb3 A T 1: 193,321,053 D100V probably damaging Het
Map2 A G 1: 66,416,106 D1385G probably damaging Het
Mettl25 C T 10: 105,826,525 V195I probably damaging Het
Myh8 A G 11: 67,301,692 T1466A probably benign Het
Myo3b T A 2: 70,105,425 C61S probably benign Het
Nacc2 T G 2: 26,062,261 N361T probably damaging Het
Nf1 A T 11: 79,418,574 K438M possibly damaging Het
Nipal4 A G 11: 46,150,441 V309A possibly damaging Het
Nomo1 T C 7: 46,079,594 probably null Het
Nubp2 T C 17: 24,884,471 E144G probably damaging Het
Nwd2 A T 5: 63,800,124 I266F probably benign Het
Olfr1126 T C 2: 87,458,037 F291L probably benign Het
Olfr593 G A 7: 103,212,726 V289M possibly damaging Het
Olfr694 A G 7: 106,689,255 Y159H probably benign Het
Orc1 T C 4: 108,595,646 probably null Het
Otogl T A 10: 107,806,696 N1291I probably damaging Het
Pah C T 10: 87,567,281 P173S possibly damaging Het
Pga5 A G 19: 10,669,453 Y305H probably damaging Het
Plekha4 A G 7: 45,532,358 H62R probably damaging Het
Plxnd1 G T 6: 115,968,793 D906E probably benign Het
Ppfia4 T C 1: 134,329,189 E98G possibly damaging Het
Ptk2 A T 15: 73,343,283 probably null Het
Raet1e C A 10: 22,180,862 H112Q possibly damaging Het
Scai T A 2: 39,075,042 I597F probably benign Het
Slc35c2 C T 2: 165,280,837 G176S probably damaging Het
Slc35f4 A T 14: 49,304,256 I347N possibly damaging Het
Slc52a3 T C 2: 152,008,156 *461Q probably null Het
Slc6a1 G A 6: 114,302,800 V142I probably benign Het
Tbc1d31 C A 15: 57,940,753 T388N probably benign Het
Tmem63c T C 12: 87,075,639 W404R probably damaging Het
Tmem79 A G 3: 88,333,321 S107P probably benign Het
Trip11 C T 12: 101,884,728 E741K probably damaging Het
Trpm5 G T 7: 143,082,958 T414N probably damaging Het
Tsnaxip1 T A 8: 105,844,488 I660N possibly damaging Het
Ube2q2 T C 9: 55,163,007 S78P probably damaging Het
Vac14 A T 8: 110,635,375 probably null Het
Vps51 G T 19: 6,071,437 S185* probably null Het
Zfp11 C T 5: 129,658,238 G53E possibly damaging Het
Zfp532 A T 18: 65,682,985 I810F possibly damaging Het
Zfp599 C T 9: 22,249,759 C370Y probably damaging Het
Other mutations in Cacna1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Cacna1d APN 14 30096950 missense probably damaging 0.97
IGL00857:Cacna1d APN 14 30350681 missense possibly damaging 0.83
IGL01015:Cacna1d APN 14 30051742 splice site probably benign
IGL01420:Cacna1d APN 14 30051638 missense probably benign 0.01
IGL01470:Cacna1d APN 14 30099142 missense probably damaging 0.99
IGL01560:Cacna1d APN 14 30099206 missense probably benign 0.00
IGL01617:Cacna1d APN 14 30102371 missense probably damaging 1.00
IGL01820:Cacna1d APN 14 30042866 missense possibly damaging 0.79
IGL01948:Cacna1d APN 14 30124794 missense probably damaging 1.00
IGL02702:Cacna1d APN 14 30123533 nonsense probably null
IGL02864:Cacna1d APN 14 30051706 missense probably benign 0.10
IGL03082:Cacna1d APN 14 30099233 missense probably damaging 1.00
R0015:Cacna1d UTSW 14 30114971 missense probably benign 0.00
R0015:Cacna1d UTSW 14 30114971 missense probably benign 0.00
R0033:Cacna1d UTSW 14 30105489 missense probably damaging 0.99
R0047:Cacna1d UTSW 14 30346790 splice site probably benign
R0047:Cacna1d UTSW 14 30346790 splice site probably benign
R0051:Cacna1d UTSW 14 30111095 missense probably damaging 1.00
R0051:Cacna1d UTSW 14 30111095 missense probably damaging 1.00
R0067:Cacna1d UTSW 14 30075010 unclassified probably benign
R0067:Cacna1d UTSW 14 30075010 unclassified probably benign
R0238:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0238:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0239:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0240:Cacna1d UTSW 14 30096969 missense probably benign 0.00
R0240:Cacna1d UTSW 14 30096969 missense probably benign 0.00
R0284:Cacna1d UTSW 14 30072105 missense probably damaging 1.00
R0416:Cacna1d UTSW 14 30100688 splice site probably benign
R0427:Cacna1d UTSW 14 30346817 missense probably damaging 0.99
R0517:Cacna1d UTSW 14 30179275 missense probably damaging 1.00
R0639:Cacna1d UTSW 14 30171294 critical splice donor site probably null
R0727:Cacna1d UTSW 14 30130115 critical splice donor site probably null
R0732:Cacna1d UTSW 14 30042920 missense probably damaging 0.99
R0843:Cacna1d UTSW 14 30124871 missense probably damaging 1.00
R0900:Cacna1d UTSW 14 30111082 missense probably damaging 1.00
R1278:Cacna1d UTSW 14 30178703 missense probably damaging 1.00
R1340:Cacna1d UTSW 14 30072067 missense probably damaging 0.96
R1527:Cacna1d UTSW 14 30107796 missense probably damaging 1.00
R1711:Cacna1d UTSW 14 30066056 missense probably damaging 1.00
R1736:Cacna1d UTSW 14 30089863 missense probably damaging 1.00
R1763:Cacna1d UTSW 14 30099196 missense probably benign 0.25
R2034:Cacna1d UTSW 14 30089863 missense probably damaging 1.00
R2086:Cacna1d UTSW 14 30047357 missense possibly damaging 0.83
R2126:Cacna1d UTSW 14 30123163 missense probably damaging 1.00
R2218:Cacna1d UTSW 14 30123091 missense probably damaging 1.00
R2219:Cacna1d UTSW 14 30042090 missense probably damaging 1.00
R2262:Cacna1d UTSW 14 30491016 missense possibly damaging 0.46
R2291:Cacna1d UTSW 14 30042342 missense probably damaging 1.00
R2399:Cacna1d UTSW 14 30052487 missense probably benign 0.34
R2424:Cacna1d UTSW 14 30049023 missense probably damaging 0.96
R2568:Cacna1d UTSW 14 30082511 missense probably damaging 0.99
R4038:Cacna1d UTSW 14 30066083 missense probably damaging 0.96
R4509:Cacna1d UTSW 14 30096971 missense probably damaging 1.00
R4649:Cacna1d UTSW 14 30095408 missense probably benign
R4650:Cacna1d UTSW 14 30095408 missense probably benign
R4652:Cacna1d UTSW 14 30095408 missense probably benign
R5009:Cacna1d UTSW 14 30079332 missense probably damaging 1.00
R5058:Cacna1d UTSW 14 30114244 nonsense probably null
R5063:Cacna1d UTSW 14 30051383 missense probably benign
R5138:Cacna1d UTSW 14 30490972 missense probably benign
R5151:Cacna1d UTSW 14 30123323 missense probably damaging 1.00
R5278:Cacna1d UTSW 14 30352924 critical splice donor site probably null
R5286:Cacna1d UTSW 14 30350725 missense possibly damaging 0.69
R5313:Cacna1d UTSW 14 30346841 missense probably benign 0.38
R5383:Cacna1d UTSW 14 30045279 missense possibly damaging 0.51
R5387:Cacna1d UTSW 14 30100751 missense probably damaging 1.00
R5514:Cacna1d UTSW 14 30350833 nonsense probably null
R5524:Cacna1d UTSW 14 30042129 missense probably benign 0.01
R5663:Cacna1d UTSW 14 30123340 missense probably damaging 1.00
R5712:Cacna1d UTSW 14 30074997 missense probably damaging 1.00
R5796:Cacna1d UTSW 14 30066116 missense probably damaging 1.00
R5906:Cacna1d UTSW 14 30096960 missense probably damaging 1.00
R5923:Cacna1d UTSW 14 30111148 missense probably damaging 1.00
R5936:Cacna1d UTSW 14 30171314 missense possibly damaging 0.91
R5938:Cacna1d UTSW 14 30103735 missense probably damaging 1.00
R6041:Cacna1d UTSW 14 30042357 missense probably damaging 1.00
R6432:Cacna1d UTSW 14 30123454 missense probably damaging 1.00
R6486:Cacna1d UTSW 14 30114233 missense probably benign 0.01
R6600:Cacna1d UTSW 14 30114235 missense probably benign 0.15
R6661:Cacna1d UTSW 14 30089875 missense probably damaging 1.00
R6753:Cacna1d UTSW 14 30042786 missense probably damaging 1.00
R6804:Cacna1d UTSW 14 30051665 missense probably benign 0.00
R6851:Cacna1d UTSW 14 30042782 missense probably damaging 1.00
R6863:Cacna1d UTSW 14 30075852 missense probably damaging 1.00
R6916:Cacna1d UTSW 14 30095364 missense probably damaging 1.00
R6925:Cacna1d UTSW 14 30051637 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGTCCAGTGCCTAAGAGTCAAGAG -3'
(R):5'- GGATAAGGCCATCTACATCTGCCG -3'

Sequencing Primer
(F):5'- TCCTGTGAGGGAGGGGAC -3'
(R):5'- TGCCGTGGGCACTGATAAAG -3'
Posted On2013-05-09