Incidental Mutation 'R4859:Rapgef6'
ID372343
Institutional Source Beutler Lab
Gene Symbol Rapgef6
Ensembl Gene ENSMUSG00000037533
Gene NameRap guanine nucleotide exchange factor (GEF) 6
SynonymsPDZ-GEF2, Pdzgef2, C030018K18Rik, RA-GEF-2
MMRRC Submission 042470-MU
Accession Numbers

Genbank: NM_175258; MGI: 2384761

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4859 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location54522847-54699285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54636163 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 413 (E413G)
Ref Sequence ENSEMBL: ENSMUSP00000151509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094536] [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000108894] [ENSMUST00000108895] [ENSMUST00000207429] [ENSMUST00000218995]
Predicted Effect probably benign
Transcript: ENSMUST00000094536
AA Change: E275G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092114
Gene: ENSMUSG00000037533
AA Change: E275G

DomainStartEndE-ValueType
cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 853 3.88e-84 SMART
low complexity region 944 957 N/A INTRINSIC
low complexity region 972 989 N/A INTRINSIC
low complexity region 1016 1061 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101206
AA Change: E560G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533
AA Change: E560G

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.45e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1095 5.35e-87 SMART
low complexity region 1237 1250 N/A INTRINSIC
low complexity region 1270 1293 N/A INTRINSIC
low complexity region 1345 1364 N/A INTRINSIC
low complexity region 1368 1380 N/A INTRINSIC
low complexity region 1444 1452 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1591 1604 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102743
AA Change: E560G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533
AA Change: E560G

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.42e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1138 3.88e-84 SMART
low complexity region 1229 1242 N/A INTRINSIC
low complexity region 1262 1285 N/A INTRINSIC
low complexity region 1337 1356 N/A INTRINSIC
low complexity region 1360 1372 N/A INTRINSIC
low complexity region 1436 1444 N/A INTRINSIC
low complexity region 1547 1560 N/A INTRINSIC
low complexity region 1583 1596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108894
AA Change: E275G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104522
Gene: ENSMUSG00000037533
AA Change: E275G

DomainStartEndE-ValueType
cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 810 5.35e-87 SMART
low complexity region 952 965 N/A INTRINSIC
low complexity region 980 997 N/A INTRINSIC
low complexity region 1024 1069 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108895
SMART Domains Protein: ENSMUSP00000104523
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.95e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 526 1.03e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149372
Predicted Effect probably benign
Transcript: ENSMUST00000207429
AA Change: E560G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000218995
AA Change: E413G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220269
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.5%
Validation Efficiency 100% (112/112)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik G T 11: 29,825,178 A93E probably damaging Het
Adam25 T A 8: 40,754,543 V282E probably benign Het
Adam26b T C 8: 43,520,259 T569A possibly damaging Het
Adam6a A G 12: 113,545,989 N661D probably damaging Het
Adck1 G A 12: 88,441,095 A199T probably benign Het
Adhfe1 A G 1: 9,558,213 Y270C probably damaging Het
Aldh16a1 C T 7: 45,147,307 R256H probably benign Het
Ap5z1 T C 5: 142,473,993 M466T possibly damaging Het
Aspm C T 1: 139,469,393 L908F probably damaging Het
Atp8b2 T A 3: 89,945,980 T743S probably benign Het
Bag2 G T 1: 33,746,941 T100K probably damaging Het
Camk2a A G 18: 60,943,174 probably benign Het
Ccdc158 A G 5: 92,633,403 Y848H probably damaging Het
Ccp110 T G 7: 118,725,430 V725G possibly damaging Het
Cdh6 A G 15: 13,051,332 V405A probably benign Het
Ces2g T C 8: 104,967,462 probably null Het
Cfap157 A G 2: 32,777,542 F510L probably benign Het
Chd3 A T 11: 69,359,896 M669K possibly damaging Het
Cnot10 C T 9: 114,627,464 A168T probably damaging Het
Crybg1 A G 10: 43,992,569 V1371A probably damaging Het
Dars2 A G 1: 161,044,990 L547P probably damaging Het
Dis3 A G 14: 99,087,790 C483R probably damaging Het
Dnah7b T A 1: 46,356,602 L3888Q probably damaging Het
Dpysl2 A T 14: 66,829,439 Y182N probably damaging Het
Eif4g1 T A 16: 20,682,173 F509L probably benign Het
Evc T C 5: 37,300,909 T85A probably damaging Het
Fam196b A G 11: 34,403,154 S399G probably benign Het
Farsb T C 1: 78,467,972 T283A probably benign Het
Fgf14 C A 14: 124,192,433 R30L possibly damaging Het
Gbe1 T C 16: 70,478,401 L363P probably damaging Het
Gcg A G 2: 62,476,845 V124A probably damaging Het
Glb1l A G 1: 75,200,319 probably benign Het
Gm11757 A G 4: 73,887,220 S351P probably damaging Het
Gm5431 T C 11: 48,889,582 E449G probably damaging Het
Gon4l T C 3: 88,895,348 S1089P probably benign Het
Hgd T C 16: 37,588,749 L25P probably damaging Het
Hnf1a T C 5: 114,955,252 H318R possibly damaging Het
Hsd17b7 A C 1: 169,967,257 V71G possibly damaging Het
Hydin T C 8: 110,506,494 S1742P possibly damaging Het
Kank2 T C 9: 21,779,782 E552G probably benign Het
Kcnq4 C A 4: 120,716,613 R217L probably damaging Het
Klrg2 T C 6: 38,627,605 *201W probably null Het
Kndc1 T C 7: 139,921,905 S953P probably benign Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Lonp1 A G 17: 56,626,587 V96A probably benign Het
Mgat4e T C 1: 134,541,740 K189E possibly damaging Het
Msh2 G A 17: 87,718,759 V722I possibly damaging Het
N4bp2 T C 5: 65,825,298 Y1632H probably damaging Het
Nlrc4 T G 17: 74,436,037 K862T probably damaging Het
Notch4 A T 17: 34,587,180 Q1750L probably damaging Het
Obscn C T 11: 59,082,023 V2066I possibly damaging Het
Olfr1031 T C 2: 85,992,731 S305P probably damaging Het
Olfr1211 T A 2: 88,930,283 I11L probably benign Het
Olfr1307 A T 2: 111,944,811 I215N probably damaging Het
Olfr1396 T C 11: 49,113,166 K187E probably damaging Het
Olfr607 A T 7: 103,461,036 Y57* probably null Het
Pde7a T A 3: 19,241,491 probably benign Het
Pign A T 1: 105,648,167 Y249* probably null Het
Ppp1r17 A T 6: 56,026,464 E87D probably damaging Het
Prss3 T A 6: 41,373,923 Q211L probably damaging Het
Rnf150 A G 8: 82,864,083 H25R probably damaging Het
Scamp2 T C 9: 57,581,651 probably null Het
Scap T A 9: 110,374,342 probably benign Het
Sdc2 A C 15: 33,032,456 K175N probably damaging Het
Serpinb6d T A 13: 33,667,564 probably null Het
Sh3tc2 A G 18: 62,013,093 N1181S probably benign Het
Slc44a2 T C 9: 21,348,145 I46T probably damaging Het
Slfn8 A G 11: 83,017,714 M1T probably null Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Soga3 A C 10: 29,150,394 M491L probably benign Het
Spata1 C G 3: 146,469,774 D326H probably damaging Het
Tbck T G 3: 132,801,527 S753R probably benign Het
Tdp1 A G 12: 99,909,811 I340M probably benign Het
Tmprss6 T A 15: 78,446,677 Y50F probably damaging Het
Trank1 T A 9: 111,365,010 S701T probably benign Het
Trbv17 A T 6: 41,163,289 N26I probably benign Het
Trip12 A T 1: 84,793,810 S248T probably damaging Het
Vmn2r53 T G 7: 12,601,403 Q110P probably damaging Het
Vmn2r75 A G 7: 86,148,403 V734A probably benign Het
Wfdc11 A T 2: 164,665,495 M14K probably null Het
Xcr1 T A 9: 123,856,647 M17L probably benign Het
Zbtb40 A G 4: 136,988,759 I965T probably damaging Het
Zfp760 A T 17: 21,723,530 H562L probably damaging Het
Zfp760 A T 17: 21,723,535 R564* probably null Het
Znf41-ps T A 4: 145,828,713 noncoding transcript Het
Zyg11a A T 4: 108,210,190 I41N probably damaging Het
Other mutations in Rapgef6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Rapgef6 APN 11 54679265 missense probably benign 0.00
IGL00507:Rapgef6 APN 11 54664109 nonsense probably null
IGL00809:Rapgef6 APN 11 54649300 missense probably damaging 1.00
IGL00843:Rapgef6 APN 11 54691273 missense probably benign 0.03
IGL00899:Rapgef6 APN 11 54620018 nonsense probably null
IGL01372:Rapgef6 APN 11 54668611 splice site probably benign
IGL01604:Rapgef6 APN 11 54694563 missense probably damaging 0.99
IGL01935:Rapgef6 APN 11 54610842 missense possibly damaging 0.78
IGL01991:Rapgef6 APN 11 54552869 missense probably benign 0.37
IGL02243:Rapgef6 APN 11 54676400 missense probably damaging 1.00
IGL02407:Rapgef6 APN 11 54676355 missense possibly damaging 0.91
IGL02676:Rapgef6 APN 11 54649346 unclassified probably benign
IGL02934:Rapgef6 APN 11 54625864 missense probably damaging 1.00
IGL03076:Rapgef6 APN 11 54625967 missense probably damaging 1.00
IGL03110:Rapgef6 APN 11 54696089 missense probably damaging 0.97
IGL03256:Rapgef6 APN 11 54657429 missense probably damaging 1.00
shocker UTSW 11 54620016 missense probably damaging 1.00
D4216:Rapgef6 UTSW 11 54668746 splice site probably benign
PIT4305001:Rapgef6 UTSW 11 54679377 missense probably damaging 1.00
PIT4366001:Rapgef6 UTSW 11 54691620 missense probably damaging 0.98
R0047:Rapgef6 UTSW 11 54546378 missense possibly damaging 0.65
R0047:Rapgef6 UTSW 11 54546378 missense possibly damaging 0.65
R0125:Rapgef6 UTSW 11 54625875 nonsense probably null
R0189:Rapgef6 UTSW 11 54691249 missense probably benign
R0201:Rapgef6 UTSW 11 54619941 missense probably damaging 1.00
R0505:Rapgef6 UTSW 11 54625963 missense probably benign 0.00
R0524:Rapgef6 UTSW 11 54690284 missense probably benign 0.32
R0853:Rapgef6 UTSW 11 54668677 missense probably damaging 1.00
R1203:Rapgef6 UTSW 11 54691699 missense probably benign 0.09
R1440:Rapgef6 UTSW 11 54626708 missense probably damaging 1.00
R1453:Rapgef6 UTSW 11 54639727 intron probably null
R1530:Rapgef6 UTSW 11 54661183 missense probably damaging 1.00
R1593:Rapgef6 UTSW 11 54546397 frame shift probably null
R1620:Rapgef6 UTSW 11 54626594 missense possibly damaging 0.88
R1628:Rapgef6 UTSW 11 54546397 frame shift probably null
R1629:Rapgef6 UTSW 11 54546397 frame shift probably null
R1630:Rapgef6 UTSW 11 54546397 frame shift probably null
R1634:Rapgef6 UTSW 11 54546397 frame shift probably null
R1640:Rapgef6 UTSW 11 54657405 missense probably damaging 1.00
R1686:Rapgef6 UTSW 11 54691632 missense possibly damaging 0.81
R1722:Rapgef6 UTSW 11 54546397 frame shift probably null
R1743:Rapgef6 UTSW 11 54676284 missense probably damaging 1.00
R1816:Rapgef6 UTSW 11 54694488 missense probably benign
R1851:Rapgef6 UTSW 11 54642811 missense probably benign 0.01
R1852:Rapgef6 UTSW 11 54642811 missense probably benign 0.01
R1868:Rapgef6 UTSW 11 54546397 frame shift probably null
R1888:Rapgef6 UTSW 11 54660828 missense probably damaging 1.00
R1888:Rapgef6 UTSW 11 54660828 missense probably damaging 1.00
R1942:Rapgef6 UTSW 11 54657263 missense possibly damaging 0.95
R1943:Rapgef6 UTSW 11 54657263 missense possibly damaging 0.95
R2031:Rapgef6 UTSW 11 54552858 missense probably benign 0.30
R2087:Rapgef6 UTSW 11 54631249 missense probably damaging 1.00
R2106:Rapgef6 UTSW 11 54668686 missense probably benign 0.17
R2362:Rapgef6 UTSW 11 54694272 missense probably damaging 1.00
R2484:Rapgef6 UTSW 11 54642756 missense possibly damaging 0.48
R2566:Rapgef6 UTSW 11 54687711 missense possibly damaging 0.66
R2872:Rapgef6 UTSW 11 54661175 missense probably damaging 1.00
R2872:Rapgef6 UTSW 11 54661175 missense probably damaging 1.00
R3744:Rapgef6 UTSW 11 54625934 missense probably benign 0.40
R3848:Rapgef6 UTSW 11 54691308 missense probably damaging 0.97
R4823:Rapgef6 UTSW 11 54694500 missense probably benign 0.08
R4906:Rapgef6 UTSW 11 54552836 missense probably damaging 1.00
R4911:Rapgef6 UTSW 11 54622317 missense probably damaging 0.97
R4937:Rapgef6 UTSW 11 54657317 missense probably damaging 1.00
R5033:Rapgef6 UTSW 11 54691381 missense possibly damaging 0.92
R5249:Rapgef6 UTSW 11 54523117 missense probably benign 0.19
R5304:Rapgef6 UTSW 11 54657374 missense probably benign 0.01
R5656:Rapgef6 UTSW 11 54636136 missense possibly damaging 0.95
R5701:Rapgef6 UTSW 11 54676394 missense possibly damaging 0.76
R5758:Rapgef6 UTSW 11 54668644 missense probably damaging 1.00
R5973:Rapgef6 UTSW 11 54639783 missense probably damaging 1.00
R6177:Rapgef6 UTSW 11 54620016 missense probably damaging 1.00
R6268:Rapgef6 UTSW 11 54649247 missense probably damaging 1.00
R6287:Rapgef6 UTSW 11 54626338 intron probably null
R6293:Rapgef6 UTSW 11 54634781 missense probably damaging 1.00
R6471:Rapgef6 UTSW 11 54691737 missense probably damaging 0.99
R6863:Rapgef6 UTSW 11 54546380 missense probably benign 0.00
R6950:Rapgef6 UTSW 11 54676380 missense probably benign 0.09
R7144:Rapgef6 UTSW 11 54657365 missense possibly damaging 0.78
R7171:Rapgef6 UTSW 11 54676363 missense possibly damaging 0.94
R7199:Rapgef6 UTSW 11 54546426 missense probably benign 0.00
R7291:Rapgef6 UTSW 11 54691239 missense probably benign 0.05
R7436:Rapgef6 UTSW 11 54610921 critical splice donor site probably null
R7498:Rapgef6 UTSW 11 54620004 missense probably damaging 1.00
R7506:Rapgef6 UTSW 11 54636171 missense probably benign 0.00
R7527:Rapgef6 UTSW 11 54634961 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGGTTCTAATGCTAACCATTGAAG -3'
(R):5'- CTTGGTTGGAAAAGTGAGGACC -3'

Sequencing Primer
(F):5'- GCCTGTAAGAATAGGTACATACATG -3'
(R):5'- CTAGCCAATCGGTAAGTTCCAGG -3'
Posted On2016-03-01