Incidental Mutation 'R4859:Slfn8'
ID372346
Institutional Source Beutler Lab
Gene Symbol Slfn8
Ensembl Gene ENSMUSG00000035208
Gene Nameschlafen 8
Synonyms
MMRRC Submission 042470-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R4859 (G1)
Quality Score223
Status Not validated
Chromosome11
Chromosomal Location83002158-83020810 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 83017714 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000040060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038141] [ENSMUST00000092838] [ENSMUST00000108152] [ENSMUST00000130822] [ENSMUST00000215239]
Predicted Effect probably null
Transcript: ENSMUST00000038141
AA Change: M1T

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040060
Gene: ENSMUSG00000035208
AA Change: M1T

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 1.6e-18 PFAM
Pfam:DUF2075 592 766 5.8e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000092838
AA Change: M1T

PolyPhen 2 Score 0.506 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090513
Gene: ENSMUSG00000035208
AA Change: M1T

DomainStartEndE-ValueType
Pfam:AlbA_2 205 341 1.4e-17 PFAM
Pfam:DUF2075 592 767 2.2e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108152
AA Change: M1T

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103787
Gene: ENSMUSG00000035208
AA Change: M1T

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 4.1e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000130822
AA Change: M1T

PolyPhen 2 Score 0.506 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114417
Gene: ENSMUSG00000035208
AA Change: M1T

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 3.7e-19 PFAM
SCOP:d1ly1a_ 593 625 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131883
SMART Domains Protein: ENSMUSP00000121831
Gene: ENSMUSG00000035208

DomainStartEndE-ValueType
Pfam:AlbA_2 27 163 1.8e-15 PFAM
SCOP:d1ly1a_ 370 402 2e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000215239
AA Change: M1T

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.5%
Validation Efficiency 100% (112/112)
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik G T 11: 29,825,178 A93E probably damaging Het
Adam25 T A 8: 40,754,543 V282E probably benign Het
Adam26b T C 8: 43,520,259 T569A possibly damaging Het
Adam6a A G 12: 113,545,989 N661D probably damaging Het
Adck1 G A 12: 88,441,095 A199T probably benign Het
Adhfe1 A G 1: 9,558,213 Y270C probably damaging Het
Aldh16a1 C T 7: 45,147,307 R256H probably benign Het
Ap5z1 T C 5: 142,473,993 M466T possibly damaging Het
Aspm C T 1: 139,469,393 L908F probably damaging Het
Atp8b2 T A 3: 89,945,980 T743S probably benign Het
Bag2 G T 1: 33,746,941 T100K probably damaging Het
Camk2a A G 18: 60,943,174 probably benign Het
Ccdc158 A G 5: 92,633,403 Y848H probably damaging Het
Ccp110 T G 7: 118,725,430 V725G possibly damaging Het
Cdh6 A G 15: 13,051,332 V405A probably benign Het
Ces2g T C 8: 104,967,462 probably null Het
Cfap157 A G 2: 32,777,542 F510L probably benign Het
Chd3 A T 11: 69,359,896 M669K possibly damaging Het
Cnot10 C T 9: 114,627,464 A168T probably damaging Het
Crybg1 A G 10: 43,992,569 V1371A probably damaging Het
Dars2 A G 1: 161,044,990 L547P probably damaging Het
Dis3 A G 14: 99,087,790 C483R probably damaging Het
Dnah7b T A 1: 46,356,602 L3888Q probably damaging Het
Dpysl2 A T 14: 66,829,439 Y182N probably damaging Het
Eif4g1 T A 16: 20,682,173 F509L probably benign Het
Evc T C 5: 37,300,909 T85A probably damaging Het
Fam196b A G 11: 34,403,154 S399G probably benign Het
Farsb T C 1: 78,467,972 T283A probably benign Het
Fgf14 C A 14: 124,192,433 R30L possibly damaging Het
Gbe1 T C 16: 70,478,401 L363P probably damaging Het
Gcg A G 2: 62,476,845 V124A probably damaging Het
Glb1l A G 1: 75,200,319 probably benign Het
Gm11757 A G 4: 73,887,220 S351P probably damaging Het
Gm5431 T C 11: 48,889,582 E449G probably damaging Het
Gon4l T C 3: 88,895,348 S1089P probably benign Het
Hgd T C 16: 37,588,749 L25P probably damaging Het
Hnf1a T C 5: 114,955,252 H318R possibly damaging Het
Hsd17b7 A C 1: 169,967,257 V71G possibly damaging Het
Hydin T C 8: 110,506,494 S1742P possibly damaging Het
Kank2 T C 9: 21,779,782 E552G probably benign Het
Kcnq4 C A 4: 120,716,613 R217L probably damaging Het
Klrg2 T C 6: 38,627,605 *201W probably null Het
Kndc1 T C 7: 139,921,905 S953P probably benign Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Lonp1 A G 17: 56,626,587 V96A probably benign Het
Mgat4e T C 1: 134,541,740 K189E possibly damaging Het
Msh2 G A 17: 87,718,759 V722I possibly damaging Het
N4bp2 T C 5: 65,825,298 Y1632H probably damaging Het
Nlrc4 T G 17: 74,436,037 K862T probably damaging Het
Notch4 A T 17: 34,587,180 Q1750L probably damaging Het
Obscn C T 11: 59,082,023 V2066I possibly damaging Het
Olfr1031 T C 2: 85,992,731 S305P probably damaging Het
Olfr1211 T A 2: 88,930,283 I11L probably benign Het
Olfr1307 A T 2: 111,944,811 I215N probably damaging Het
Olfr1396 T C 11: 49,113,166 K187E probably damaging Het
Olfr607 A T 7: 103,461,036 Y57* probably null Het
Pde7a T A 3: 19,241,491 probably benign Het
Pign A T 1: 105,648,167 Y249* probably null Het
Ppp1r17 A T 6: 56,026,464 E87D probably damaging Het
Prss3 T A 6: 41,373,923 Q211L probably damaging Het
Rapgef6 A G 11: 54,636,163 E413G probably benign Het
Rnf150 A G 8: 82,864,083 H25R probably damaging Het
Scamp2 T C 9: 57,581,651 probably null Het
Scap T A 9: 110,374,342 probably benign Het
Sdc2 A C 15: 33,032,456 K175N probably damaging Het
Serpinb6d T A 13: 33,667,564 probably null Het
Sh3tc2 A G 18: 62,013,093 N1181S probably benign Het
Slc44a2 T C 9: 21,348,145 I46T probably damaging Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Soga3 A C 10: 29,150,394 M491L probably benign Het
Spata1 C G 3: 146,469,774 D326H probably damaging Het
Tbck T G 3: 132,801,527 S753R probably benign Het
Tdp1 A G 12: 99,909,811 I340M probably benign Het
Tmprss6 T A 15: 78,446,677 Y50F probably damaging Het
Trank1 T A 9: 111,365,010 S701T probably benign Het
Trbv17 A T 6: 41,163,289 N26I probably benign Het
Trip12 A T 1: 84,793,810 S248T probably damaging Het
Vmn2r53 T G 7: 12,601,403 Q110P probably damaging Het
Vmn2r75 A G 7: 86,148,403 V734A probably benign Het
Wfdc11 A T 2: 164,665,495 M14K probably null Het
Xcr1 T A 9: 123,856,647 M17L probably benign Het
Zbtb40 A G 4: 136,988,759 I965T probably damaging Het
Zfp760 A T 17: 21,723,530 H562L probably damaging Het
Zfp760 A T 17: 21,723,535 R564* probably null Het
Znf41-ps T A 4: 145,828,713 noncoding transcript Het
Zyg11a A T 4: 108,210,190 I41N probably damaging Het
Other mutations in Slfn8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Slfn8 APN 11 83013484 missense possibly damaging 0.75
IGL01418:Slfn8 APN 11 83004636 missense probably damaging 1.00
IGL01620:Slfn8 APN 11 83004233 nonsense probably null
IGL01875:Slfn8 APN 11 83004079 missense probably benign 0.30
IGL01896:Slfn8 APN 11 83003696 missense probably damaging 1.00
IGL01929:Slfn8 APN 11 83003405 nonsense probably null
IGL02111:Slfn8 APN 11 83004498 missense probably damaging 1.00
IGL02136:Slfn8 APN 11 83003465 nonsense probably null
IGL02165:Slfn8 APN 11 83017196 missense probably benign 0.00
IGL02645:Slfn8 APN 11 83003554 missense possibly damaging 0.82
IGL02682:Slfn8 APN 11 83003691 missense probably damaging 1.00
IGL02689:Slfn8 APN 11 83017108 missense probably damaging 1.00
IGL02948:Slfn8 APN 11 83003252 missense probably damaging 0.99
IGL03037:Slfn8 APN 11 83003252 missense probably damaging 0.99
IGL03185:Slfn8 APN 11 83017507 missense probably benign 0.01
IGL03243:Slfn8 APN 11 83003707 missense probably damaging 1.00
IGL03286:Slfn8 APN 11 83013468 missense probably damaging 0.99
R0295:Slfn8 UTSW 11 83003343 nonsense probably null
R0368:Slfn8 UTSW 11 83017132 missense probably damaging 1.00
R0382:Slfn8 UTSW 11 83004556 missense probably damaging 1.00
R0655:Slfn8 UTSW 11 83003821 missense probably benign 0.35
R0894:Slfn8 UTSW 11 83003581 missense probably benign 0.07
R1006:Slfn8 UTSW 11 83003511 missense possibly damaging 0.69
R1181:Slfn8 UTSW 11 83016745 missense probably benign 0.19
R1187:Slfn8 UTSW 11 83003488 missense probably damaging 1.00
R1501:Slfn8 UTSW 11 83003180 missense probably damaging 0.99
R1646:Slfn8 UTSW 11 83016886 missense probably damaging 1.00
R1909:Slfn8 UTSW 11 83003621 nonsense probably null
R2005:Slfn8 UTSW 11 83004150 missense probably damaging 1.00
R2363:Slfn8 UTSW 11 83004094 missense probably damaging 1.00
R3780:Slfn8 UTSW 11 83017454 missense probably benign 0.13
R3890:Slfn8 UTSW 11 83004444 missense possibly damaging 0.68
R3917:Slfn8 UTSW 11 83016993 nonsense probably null
R4559:Slfn8 UTSW 11 83004744 missense probably damaging 1.00
R4684:Slfn8 UTSW 11 83017506 missense probably benign 0.10
R4767:Slfn8 UTSW 11 83003197 missense possibly damaging 0.66
R4773:Slfn8 UTSW 11 83017393 missense probably damaging 1.00
R4916:Slfn8 UTSW 11 83016878 missense probably damaging 1.00
R4939:Slfn8 UTSW 11 83003285 missense probably benign 0.01
R5107:Slfn8 UTSW 11 83017150 missense probably damaging 0.99
R5130:Slfn8 UTSW 11 83003821 missense probably benign 0.35
R5165:Slfn8 UTSW 11 83017127 missense probably damaging 0.99
R5238:Slfn8 UTSW 11 83013388 missense probably damaging 0.96
R5282:Slfn8 UTSW 11 83017724 critical splice acceptor site probably null
R5311:Slfn8 UTSW 11 83004084 missense probably damaging 1.00
R5499:Slfn8 UTSW 11 83004216 missense probably damaging 0.99
R5617:Slfn8 UTSW 11 83004721 missense probably benign 0.01
R5782:Slfn8 UTSW 11 83017041 missense probably damaging 0.98
R5823:Slfn8 UTSW 11 83016736 missense probably benign 0.01
R5886:Slfn8 UTSW 11 83003334 missense probably benign 0.09
R5933:Slfn8 UTSW 11 83003335 missense probably benign 0.00
R6151:Slfn8 UTSW 11 83017321 missense probably damaging 1.00
R6163:Slfn8 UTSW 11 83003864 makesense probably null
R6191:Slfn8 UTSW 11 83016800 missense possibly damaging 0.72
R6419:Slfn8 UTSW 11 83004055 unclassified probably null
R6925:Slfn8 UTSW 11 83013417 nonsense probably null
R7065:Slfn8 UTSW 11 83016968 missense probably benign 0.01
R7380:Slfn8 UTSW 11 83003740 missense not run
R7414:Slfn8 UTSW 11 83016792 nonsense probably null
X0021:Slfn8 UTSW 11 83016928 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- ACAGGATGCTCACTCTTGTTAG -3'
(R):5'- TGATTGCCCCTTCAAAACAGTTTC -3'

Sequencing Primer
(F):5'- TGCATAGCAATTAATCCTCCTCCAG -3'
(R):5'- TGCCCCTTCAAAACAGTTTCTAAAG -3'
Posted On2016-03-01