Incidental Mutation 'R0239:Vps51'
ID37240
Institutional Source Beutler Lab
Gene Symbol Vps51
Ensembl Gene ENSMUSG00000024797
Gene NameVPS51 GARP complex subunit
Synonyms
MMRRC Submission 038477-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R0239 (G1)
Quality Score204
Status Not validated
Chromosome19
Chromosomal Location6067842-6080324 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 6071437 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 185 (S185*)
Ref Sequence ENSEMBL: ENSMUSP00000123994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025711] [ENSMUST00000025713] [ENSMUST00000113543] [ENSMUST00000159084] [ENSMUST00000159832] [ENSMUST00000160028] [ENSMUST00000160233] [ENSMUST00000160590] [ENSMUST00000161090] [ENSMUST00000161528] [ENSMUST00000161718] [ENSMUST00000162575] [ENSMUST00000162810]
Predicted Effect probably null
Transcript: ENSMUST00000025711
AA Change: S185*
SMART Domains Protein: ENSMUSP00000025711
Gene: ENSMUSG00000024799
AA Change: S185*

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:COG2 56 191 2.6e-10 PFAM
Pfam:DUF2450 62 250 2.3e-14 PFAM
Pfam:Vps51 63 149 1.1e-26 PFAM
Pfam:Dor1 75 246 1.8e-19 PFAM
Pfam:Zw10 83 291 2.2e-8 PFAM
Pfam:Sec5 101 275 6.5e-24 PFAM
low complexity region 377 391 N/A INTRINSIC
low complexity region 523 532 N/A INTRINSIC
low complexity region 743 758 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000025713
SMART Domains Protein: ENSMUSP00000025713
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 418 1.6e-141 PFAM
Pfam:DUF1295 250 409 9.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113543
SMART Domains Protein: ENSMUSP00000109171
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 373 9.9e-112 PFAM
Pfam:DUF1295 249 396 2.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159084
SMART Domains Protein: ENSMUSP00000124868
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 300 6.4e-75 PFAM
Pfam:ERG4_ERG24 292 391 2.2e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159211
Predicted Effect probably benign
Transcript: ENSMUST00000159475
Predicted Effect probably null
Transcript: ENSMUST00000159832
AA Change: S185*
SMART Domains Protein: ENSMUSP00000123994
Gene: ENSMUSG00000024797
AA Change: S185*

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:COG2 56 191 2e-10 PFAM
Pfam:DUF2450 62 250 1.9e-14 PFAM
Pfam:Vps51 63 149 8.3e-27 PFAM
Pfam:Dor1 75 246 1.8e-19 PFAM
Pfam:Sec5 101 275 1.6e-19 PFAM
low complexity region 276 292 N/A INTRINSIC
low complexity region 377 391 N/A INTRINSIC
low complexity region 523 532 N/A INTRINSIC
low complexity region 743 758 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159869
Predicted Effect probably benign
Transcript: ENSMUST00000160028
SMART Domains Protein: ENSMUSP00000124847
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160233
SMART Domains Protein: ENSMUSP00000124842
Gene: ENSMUSG00000024797

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160519
Predicted Effect probably benign
Transcript: ENSMUST00000160590
SMART Domains Protein: ENSMUSP00000123857
Gene: ENSMUSG00000024797

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:Vps51 63 121 2.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161090
SMART Domains Protein: ENSMUSP00000125543
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161222
Predicted Effect probably benign
Transcript: ENSMUST00000161528
SMART Domains Protein: ENSMUSP00000123989
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 109 5.3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161634
Predicted Effect probably benign
Transcript: ENSMUST00000161718
SMART Domains Protein: ENSMUSP00000124283
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 1 197 5.7e-86 PFAM
Pfam:DUF1295 46 185 1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162549
Predicted Effect probably benign
Transcript: ENSMUST00000162575
SMART Domains Protein: ENSMUSP00000125586
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:ERG4_ERG24 51 229 5.5e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162721
Predicted Effect probably benign
Transcript: ENSMUST00000162810
SMART Domains Protein: ENSMUSP00000124825
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 9 124 6.9e-34 PFAM
Meta Mutation Damage Score 0.608 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.9%
Validation Efficiency 100% (3/3)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vacuolar protein sorting-associated protein 51 family. The encoded protein is a component of the Golgi-associated retrograde protein complex which acts as a tethering factor for carriers in retrograde transport from the early and late endosomes to the trans-Golgi network. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik TTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCC 3: 138,065,834 probably benign Het
Adra1d C A 2: 131,546,214 V474F probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Ash1l A G 3: 89,067,222 D2618G possibly damaging Het
Atp6v1c2 C A 12: 17,294,675 probably null Het
Cacna1d A G 14: 30,123,496 V572A probably benign Het
Camta1 A G 4: 151,143,730 W882R probably damaging Het
Cd72 A G 4: 43,453,163 V91A probably benign Het
Cdh12 T C 15: 21,586,407 W771R probably damaging Het
Cdx2 G T 5: 147,303,287 T193K probably damaging Het
Cfap70 A C 14: 20,448,605 S5A probably benign Het
Chmp7 A G 14: 69,720,997 V241A probably damaging Het
D3Ertd751e A G 3: 41,753,878 Y150C probably damaging Het
Depdc5 T C 5: 32,943,240 S832P probably damaging Het
Dnhd1 A G 7: 105,721,531 S4673G probably benign Het
Dock4 G T 12: 40,737,540 S818I probably damaging Het
Dysf C T 6: 84,064,479 Q156* probably null Het
Espnl T C 1: 91,322,287 V52A probably damaging Het
Flcn T C 11: 59,801,076 N249S probably benign Het
Gemin6 C A 17: 80,225,710 A24D probably damaging Het
Gm5773 A G 3: 93,774,032 H337R probably benign Het
Gm9733 A G 3: 15,296,601 L163P probably damaging Het
Hal T C 10: 93,503,482 S478P possibly damaging Het
Hectd1 T A 12: 51,769,318 M1324L possibly damaging Het
Hyal5 T A 6: 24,876,344 L72Q probably damaging Het
Ift140 C A 17: 25,045,523 C557* probably null Het
Ikbkap C A 4: 56,784,596 V466L probably benign Het
Kbtbd3 G T 9: 4,330,144 V173L possibly damaging Het
Kif14 A G 1: 136,527,393 E1551G probably damaging Het
Krt17 G A 11: 100,260,878 R30* probably null Het
Lamb3 A T 1: 193,321,053 D100V probably damaging Het
Map2 A G 1: 66,416,106 D1385G probably damaging Het
Mettl25 C T 10: 105,826,525 V195I probably damaging Het
Myh8 A G 11: 67,301,692 T1466A probably benign Het
Myo3b T A 2: 70,105,425 C61S probably benign Het
Nacc2 T G 2: 26,062,261 N361T probably damaging Het
Nf1 A T 11: 79,418,574 K438M possibly damaging Het
Nipal4 A G 11: 46,150,441 V309A possibly damaging Het
Nomo1 T C 7: 46,079,594 probably null Het
Nubp2 T C 17: 24,884,471 E144G probably damaging Het
Nwd2 A T 5: 63,800,124 I266F probably benign Het
Olfr1126 T C 2: 87,458,037 F291L probably benign Het
Olfr593 G A 7: 103,212,726 V289M possibly damaging Het
Olfr694 A G 7: 106,689,255 Y159H probably benign Het
Orc1 T C 4: 108,595,646 probably null Het
Otogl T A 10: 107,806,696 N1291I probably damaging Het
Pah C T 10: 87,567,281 P173S possibly damaging Het
Pga5 A G 19: 10,669,453 Y305H probably damaging Het
Plekha4 A G 7: 45,532,358 H62R probably damaging Het
Plxnd1 G T 6: 115,968,793 D906E probably benign Het
Ppfia4 T C 1: 134,329,189 E98G possibly damaging Het
Ptk2 A T 15: 73,343,283 probably null Het
Raet1e C A 10: 22,180,862 H112Q possibly damaging Het
Scai T A 2: 39,075,042 I597F probably benign Het
Slc35c2 C T 2: 165,280,837 G176S probably damaging Het
Slc35f4 A T 14: 49,304,256 I347N possibly damaging Het
Slc52a3 T C 2: 152,008,156 *461Q probably null Het
Slc6a1 G A 6: 114,302,800 V142I probably benign Het
Tbc1d31 C A 15: 57,940,753 T388N probably benign Het
Tmem63c T C 12: 87,075,639 W404R probably damaging Het
Tmem79 A G 3: 88,333,321 S107P probably benign Het
Trip11 C T 12: 101,884,728 E741K probably damaging Het
Trpm5 G T 7: 143,082,958 T414N probably damaging Het
Tsnaxip1 T A 8: 105,844,488 I660N possibly damaging Het
Ube2q2 T C 9: 55,163,007 S78P probably damaging Het
Vac14 A T 8: 110,635,375 probably null Het
Zfp11 C T 5: 129,658,238 G53E possibly damaging Het
Zfp532 A T 18: 65,682,985 I810F possibly damaging Het
Zfp599 C T 9: 22,249,759 C370Y probably damaging Het
Other mutations in Vps51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03095:Vps51 APN 19 6070048 missense probably damaging 1.00
R0238:Vps51 UTSW 19 6071437 nonsense probably null
R0238:Vps51 UTSW 19 6071437 nonsense probably null
R0239:Vps51 UTSW 19 6071437 nonsense probably null
R1533:Vps51 UTSW 19 6071467 missense probably benign 0.04
R1909:Vps51 UTSW 19 6069469 missense probably benign 0.03
R2022:Vps51 UTSW 19 6071582 missense probably benign 0.02
R2146:Vps51 UTSW 19 6068134 missense probably benign 0.25
R2148:Vps51 UTSW 19 6068134 missense probably benign 0.25
R2149:Vps51 UTSW 19 6068134 missense probably benign 0.25
R2901:Vps51 UTSW 19 6076438 missense probably damaging 0.99
R3717:Vps51 UTSW 19 6077168 utr 3 prime probably benign
R3769:Vps51 UTSW 19 6076348 missense possibly damaging 0.54
R5192:Vps51 UTSW 19 6070467 missense possibly damaging 0.88
R5210:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5256:Vps51 UTSW 19 6070488 missense probably benign 0.00
R5260:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5261:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5274:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5294:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5295:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5389:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5391:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5392:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5393:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5421:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5422:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5497:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5498:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5499:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5671:Vps51 UTSW 19 6068194 missense probably benign 0.18
R5963:Vps51 UTSW 19 6068290 missense probably damaging 1.00
R5989:Vps51 UTSW 19 6076372 missense probably damaging 0.96
R6427:Vps51 UTSW 19 6070917 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TTTGGAGAACAATGACCAGGCCC -3'
(R):5'- GCTCAACTCTTGCCCATCTAGACAC -3'

Sequencing Primer
(F):5'- TGACCAGGCCCGGAAAC -3'
(R):5'- ACTTCAGCGCACGGATCAG -3'
Posted On2013-05-09