Incidental Mutation 'R4860:Ctnnd2'
ID372453
Institutional Source Beutler Lab
Gene Symbol Ctnnd2
Ensembl Gene ENSMUSG00000022240
Gene Namecatenin (cadherin associated protein), delta 2
SynonymsCatnd2, neurojugin, Nprap
MMRRC Submission 042471-MU
Accession Numbers

NCBI RefSeq: NM_008729.2; MGI:1195966

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4860 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location30172593-31029341 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30881167 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 731 (E731G)
Ref Sequence ENSEMBL: ENSMUSP00000154410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081728] [ENSMUST00000226119]
Predicted Effect probably damaging
Transcript: ENSMUST00000081728
AA Change: E731G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080427
Gene: ENSMUSG00000022240
AA Change: E731G

DomainStartEndE-ValueType
coiled coil region 50 84 N/A INTRINSIC
low complexity region 87 97 N/A INTRINSIC
low complexity region 148 159 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
low complexity region 238 257 N/A INTRINSIC
ARM 577 617 1.85e-8 SMART
ARM 621 662 1.15e-9 SMART
ARM 663 720 1.51e1 SMART
ARM 722 769 2.74e1 SMART
ARM 830 871 4.88e0 SMART
ARM 902 942 2.76e-7 SMART
low complexity region 964 973 N/A INTRINSIC
ARM 995 1039 5.64e-4 SMART
low complexity region 1086 1099 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000226119
AA Change: E731G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.084 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype Strain: 3056606
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adhesive junction associated protein of the armadillo/beta-catenin superfamily and is implicated in brain and eye development and cancer formation. The protein encoded by this gene promotes the disruption of E-cadherin based adherens junction to favor cell spreading upon stimulation by hepatocyte growth factor. This gene is overexpressed in prostate adenocarcinomas and is associated with decreased expression of tumor suppressor E-cadherin in this tissue. This gene resides in a region of the short arm of chromosome 5 that is deleted in Cri du Chat syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal conditioning, spatial learning and coordination behaviors and abnormal long term potentiation. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 72,455,423 S466P possibly damaging Het
1700061G19Rik A G 17: 56,888,655 N684S probably benign Het
4930435E12Rik A G 16: 38,828,145 S201P probably damaging Het
Ablim1 T C 19: 57,079,866 T267A probably damaging Het
Acap2 A T 16: 31,103,499 L724Q possibly damaging Het
Adcy4 T C 14: 55,781,927 T89A possibly damaging Het
Agrp T C 8: 105,567,368 E41G probably benign Het
Akr1d1 G A 6: 37,564,491 V308M probably damaging Het
Ap1m2 C T 9: 21,309,674 R54Q probably benign Het
Arhgap45 T A 10: 80,027,066 V692E probably damaging Het
Arid5b G T 10: 68,243,095 N137K probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
BC048679 T C 7: 81,495,720 N27D probably benign Het
Ccdc78 A G 17: 25,788,700 N237S probably benign Het
Cd46 G A 1: 195,062,396 L345F possibly damaging Het
Cngb3 A T 4: 19,425,569 N459I possibly damaging Het
Ctsh A G 9: 90,054,548 E26G probably benign Het
Cul1 G T 6: 47,517,146 K464N probably benign Het
Cul1 T A 6: 47,517,191 S479R probably damaging Het
Dcaf5 A T 12: 80,340,232 D373E probably benign Het
Ddx58 G T 4: 40,210,000 S644R probably damaging Het
Dhcr7 A G 7: 143,840,500 Q126R probably benign Het
Dok2 T C 14: 70,777,516 F228L probably damaging Het
Dpep3 T G 8: 105,976,189 I314L probably benign Het
Eps8 A G 6: 137,514,295 F362L probably damaging Het
Espn G T 4: 152,138,846 R250S probably damaging Het
Faf1 A C 4: 109,742,896 N163H probably damaging Het
Fam198b C A 3: 79,936,674 S36* probably null Het
Fam71e2 C T 7: 4,757,469 probably null Het
Fcho1 C T 8: 71,710,481 V635I probably benign Het
Gm7579 G A 7: 142,211,908 C17Y unknown Het
Gm996 T C 2: 25,578,753 Y382C probably damaging Het
Gpx8 G T 13: 113,045,508 Y130* probably null Het
Gvin1 A T 7: 106,163,436 Y609N possibly damaging Het
Hectd4 T A 5: 121,305,818 M30K probably benign Het
Iqub T C 6: 24,450,842 D586G probably damaging Het
Klhl25 T C 7: 75,867,050 I568T probably benign Het
Larp6 A G 9: 60,737,810 E411G probably damaging Het
Lepr A C 4: 101,789,337 I822L probably benign Het
Lrig3 C A 10: 126,011,052 D896E probably benign Het
Lrp1 C T 10: 127,553,824 G3114D probably damaging Het
Macf1 A T 4: 123,486,750 Y1263N probably damaging Het
Mapk10 T C 5: 102,990,619 D180G probably damaging Het
Matr3 T A 18: 35,581,640 V113E probably damaging Het
Mbd4 A T 6: 115,848,926 F368Y possibly damaging Het
Mcpt8 G A 14: 56,082,280 R238W probably benign Het
Mcrip2 G T 17: 25,864,647 T86N possibly damaging Het
Mink1 A G 11: 70,611,592 N1043S probably damaging Het
Muc4 G A 16: 32,754,616 G1497R probably benign Het
Muc4 T A 16: 32,754,625 S1500T probably benign Het
Nbeal2 G A 9: 110,635,194 T1128I probably benign Het
Nrg2 T A 18: 36,196,547 Y205F probably damaging Het
Nubp2 A G 17: 24,884,456 M149T probably benign Het
Olfr1062 T C 2: 86,422,957 T240A probably damaging Het
Olfr462 T A 11: 87,889,225 M224L probably damaging Het
Olfr974 G T 9: 39,942,504 M81I probably benign Het
Pax3 A G 1: 78,192,456 I191T possibly damaging Het
Pdcd5 T C 7: 35,643,710 N137D possibly damaging Het
Pik3c2a G A 7: 116,340,156 A1649V probably damaging Het
Pkhd1l1 T C 15: 44,537,378 S2183P possibly damaging Het
Plekho1 T A 3: 95,988,993 Q388L possibly damaging Het
Ppfibp1 A G 6: 146,990,514 T91A probably benign Het
Ptger4 G T 15: 5,242,606 N177K probably benign Het
Reln A G 5: 21,901,751 F3207S probably benign Het
Ripk4 C T 16: 97,751,536 R194H probably damaging Het
Rnf112 A T 11: 61,452,744 C112S possibly damaging Het
Rprd1b T G 2: 158,074,935 Y278* probably null Het
Sel1l A G 12: 91,831,602 L140P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc38a3 A G 9: 107,655,064 V423A probably damaging Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Slmap A T 14: 26,460,209 V323E probably benign Het
Smim6 T C 11: 115,913,504 V39A probably benign Het
Sorbs1 T C 19: 40,337,005 T382A probably benign Het
Sparc G A 11: 55,399,211 T218I possibly damaging Het
Steap1 A T 5: 5,736,589 F283I probably damaging Het
Stil A G 4: 115,038,474 T586A probably benign Het
Tbce T A 13: 14,019,795 D93V probably damaging Het
Tcf12 C T 9: 71,858,840 G504S probably null Het
Tle4 A T 19: 14,464,345 I435K probably benign Het
Tmem245 A G 4: 56,899,164 F254S probably damaging Het
Tmem251 A T 12: 102,744,055 probably benign Het
Tubgcp3 T C 8: 12,649,722 K377R probably benign Het
Ush2a A T 1: 188,553,275 T2003S probably benign Het
Usp53 A G 3: 122,961,363 S32P possibly damaging Het
Vmn1r78 T A 7: 12,152,756 L98Q probably damaging Het
Vmn2r116 A C 17: 23,401,803 Q837P probably benign Het
Vmn2r3 T C 3: 64,275,601 I226V probably benign Het
Vmn2r84 T A 10: 130,385,843 D836V probably damaging Het
Vps13d A G 4: 145,087,161 F165L probably benign Het
Vstm4 A G 14: 32,863,785 E103G possibly damaging Het
Zfp870 A T 17: 32,883,340 C339* probably null Het
Other mutations in Ctnnd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Ctnnd2 APN 15 30647141 missense possibly damaging 0.73
IGL01612:Ctnnd2 APN 15 31005018 missense probably damaging 1.00
IGL01923:Ctnnd2 APN 15 30480828 missense probably damaging 0.99
IGL02183:Ctnnd2 APN 15 31020740 missense probably damaging 1.00
IGL02186:Ctnnd2 APN 15 30480793 missense probably damaging 0.99
IGL02226:Ctnnd2 APN 15 30847336 missense probably benign 0.01
IGL02307:Ctnnd2 APN 15 30647211 missense possibly damaging 0.86
IGL02407:Ctnnd2 APN 15 30966768 missense probably damaging 1.00
IGL02474:Ctnnd2 APN 15 30669562 missense possibly damaging 0.71
IGL02718:Ctnnd2 APN 15 31027616 missense probably damaging 1.00
IGL03249:Ctnnd2 APN 15 30683236 missense probably benign 0.45
IGL03328:Ctnnd2 APN 15 30921847 splice site probably benign
carpe UTSW 15 30905820 missense probably damaging 1.00
diem UTSW 15 30683347 missense possibly damaging 0.85
P0016:Ctnnd2 UTSW 15 30966938 missense probably benign 0.00
R0130:Ctnnd2 UTSW 15 30921913 missense probably damaging 1.00
R0408:Ctnnd2 UTSW 15 30634677 missense probably damaging 1.00
R0611:Ctnnd2 UTSW 15 31009084 missense possibly damaging 0.75
R0894:Ctnnd2 UTSW 15 30332155 splice site probably benign
R1112:Ctnnd2 UTSW 15 30921880 missense probably damaging 1.00
R1459:Ctnnd2 UTSW 15 30847299 missense probably damaging 1.00
R1529:Ctnnd2 UTSW 15 30887121 missense possibly damaging 0.91
R1532:Ctnnd2 UTSW 15 30921868 missense probably damaging 1.00
R1701:Ctnnd2 UTSW 15 30921981 missense probably damaging 1.00
R1807:Ctnnd2 UTSW 15 30619871 missense probably damaging 1.00
R1881:Ctnnd2 UTSW 15 31005081 splice site probably benign
R1960:Ctnnd2 UTSW 15 30647111 missense probably damaging 0.96
R2121:Ctnnd2 UTSW 15 30669514 missense probably damaging 1.00
R3839:Ctnnd2 UTSW 15 31009028 splice site probably null
R3967:Ctnnd2 UTSW 15 30646929 missense possibly damaging 0.81
R3980:Ctnnd2 UTSW 15 30669443 missense probably benign 0.14
R4207:Ctnnd2 UTSW 15 30972827 missense probably damaging 0.99
R4279:Ctnnd2 UTSW 15 30905820 missense probably damaging 1.00
R4498:Ctnnd2 UTSW 15 30619874 missense probably damaging 1.00
R4622:Ctnnd2 UTSW 15 30887169 missense probably benign 0.17
R4622:Ctnnd2 UTSW 15 31009113 missense probably benign 0.00
R4860:Ctnnd2 UTSW 15 30881167 missense probably damaging 1.00
R4979:Ctnnd2 UTSW 15 31009075 missense probably damaging 1.00
R5086:Ctnnd2 UTSW 15 30683347 missense possibly damaging 0.85
R5330:Ctnnd2 UTSW 15 30332115 missense probably damaging 1.00
R5459:Ctnnd2 UTSW 15 30887188 missense probably damaging 1.00
R5595:Ctnnd2 UTSW 15 30669543 missense probably benign 0.07
R5809:Ctnnd2 UTSW 15 30847377 missense probably damaging 1.00
R5987:Ctnnd2 UTSW 15 30683241 missense probably benign
R6245:Ctnnd2 UTSW 15 30905748 missense probably damaging 1.00
R6379:Ctnnd2 UTSW 15 30634698 missense probably damaging 1.00
R6737:Ctnnd2 UTSW 15 30966834 nonsense probably null
R6979:Ctnnd2 UTSW 15 30619230 missense probably damaging 0.99
R7133:Ctnnd2 UTSW 15 30480849 missense possibly damaging 0.47
Z1088:Ctnnd2 UTSW 15 30966813 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TCTGAAACTCTGAGATACCATGTTGG -3'
(R):5'- GAAATACCGTGGTCACTTCCC -3'

Sequencing Primer
(F):5'- ACTCTGAGATACCATGTTGGGAGTTC -3'
(R):5'- GTGGTCACTTCCCATGGCTACTAG -3'
Posted On2016-03-01