Incidental Mutation 'R4827:Agbl5'
ID 372493
Institutional Source Beutler Lab
Gene Symbol Agbl5
Ensembl Gene ENSMUSG00000029165
Gene Name ATP/GTP binding protein-like 5
Synonyms Ccp5, 9430057O19Rik
MMRRC Submission 042443-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4827 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 31046038-31064309 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 31053158 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 83 (S83R)
Ref Sequence ENSEMBL: ENSMUSP00000144441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069705] [ENSMUST00000114700] [ENSMUST00000200695] [ENSMUST00000200850] [ENSMUST00000201168] [ENSMUST00000201225] [ENSMUST00000201817] [ENSMUST00000201917] [ENSMUST00000202060] [ENSMUST00000202109]
AlphaFold Q09M02
Predicted Effect probably damaging
Transcript: ENSMUST00000069705
AA Change: S641R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000063228
Gene: ENSMUSG00000029165
AA Change: S641R

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 191 361 8.4e-19 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 4e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114700
AA Change: S670R

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000110348
Gene: ENSMUSG00000029165
AA Change: S670R

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 220 390 1.1e-18 PFAM
low complexity region 413 428 N/A INTRINSIC
Blast:Zn_pept 453 518 5e-14 BLAST
low complexity region 567 577 N/A INTRINSIC
low complexity region 672 683 N/A INTRINSIC
low complexity region 743 762 N/A INTRINSIC
low complexity region 766 787 N/A INTRINSIC
low complexity region 824 835 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134956
AA Change: S767R
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147149
AA Change: F187V
Predicted Effect probably benign
Transcript: ENSMUST00000200695
SMART Domains Protein: ENSMUSP00000144109
Gene: ENSMUSG00000029165

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
SCOP:d2ctc__ 148 177 5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200850
SMART Domains Protein: ENSMUSP00000144274
Gene: ENSMUSG00000029165

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
SCOP:d1jqga1 178 229 1e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200990
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201901
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201167
Predicted Effect probably damaging
Transcript: ENSMUST00000201168
AA Change: S641R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143808
Gene: ENSMUSG00000029165
AA Change: S641R

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 370 7.3e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
low complexity region 836 847 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201225
AA Change: S641R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143934
Gene: ENSMUSG00000029165
AA Change: S641R

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 373 5.9e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201817
AA Change: S641R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144304
Gene: ENSMUSG00000029165
AA Change: S641R

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 372 6.4e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201917
AA Change: S641R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144188
Gene: ENSMUSG00000029165
AA Change: S641R

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 372 6.5e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
low complexity region 795 806 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201918
Predicted Effect probably damaging
Transcript: ENSMUST00000202060
AA Change: S641R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144018
Gene: ENSMUSG00000029165
AA Change: S641R

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 373 5.9e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202109
AA Change: S83R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202893
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201523
Predicted Effect probably benign
Transcript: ENSMUST00000201014
Meta Mutation Damage Score 0.0661 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a metallocarboxypeptidase involved in protein deglutamylation and a member of the peptidase M14 family of proteins. The encoded protein has been described as a "dual-functional" deglutamylase that can remove glutamate residues from both carboxyl termini and side chains of protein substrates. This deglutamylase activity may be important in antiviral immunity. Mutations in this gene are associated with retinitis pigmentosa. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to HSV or VACV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 A G 12: 88,413,489 (GRCm39) R274G probably benign Het
Ankib1 A G 5: 3,751,907 (GRCm39) I711T probably damaging Het
Arnt T A 3: 95,397,224 (GRCm39) probably null Het
Atad2 C G 15: 57,971,744 (GRCm39) V702L probably benign Het
B4galnt4 A G 7: 140,648,392 (GRCm39) E636G probably benign Het
Btbd2 A G 10: 80,482,223 (GRCm39) I244T probably damaging Het
Cenpc1 A T 5: 86,182,290 (GRCm39) N531K possibly damaging Het
Ces3b T A 8: 105,813,527 (GRCm39) M266K probably benign Het
Cfap54 A T 10: 92,737,937 (GRCm39) probably benign Het
Coq8a A G 1: 179,994,903 (GRCm39) V590A possibly damaging Het
Drc7 A G 8: 95,798,267 (GRCm39) Y504C probably damaging Het
Elovl4 T C 9: 83,688,091 (GRCm39) M1V probably null Het
Exd1 C T 2: 119,350,807 (GRCm39) A485T probably benign Het
Fads2 A G 19: 10,059,958 (GRCm39) F239L probably benign Het
Gcc2 A T 10: 58,121,953 (GRCm39) probably null Het
Ggact C T 14: 123,128,987 (GRCm39) R76H probably benign Het
Gm17535 T A 9: 3,035,786 (GRCm39) L218H probably benign Het
Gm3739 A T 14: 18,506,218 (GRCm39) F13I probably damaging Het
Gng2 T C 14: 19,925,898 (GRCm39) K65E possibly damaging Het
Gnmt A G 17: 47,038,245 (GRCm39) Y94H possibly damaging Het
Gzme C A 14: 56,356,755 (GRCm39) R69M probably null Het
Hdc G A 2: 126,436,233 (GRCm39) P546L probably benign Het
Ibtk C A 9: 85,610,607 (GRCm39) V326F probably benign Het
Inpp5b G T 4: 124,637,643 (GRCm39) probably benign Het
Kcnh7 A T 2: 62,546,564 (GRCm39) C1006S probably benign Het
Kcnk18 A T 19: 59,208,362 (GRCm39) N66I probably damaging Het
Lpar6 T A 14: 73,476,190 (GRCm39) N50K probably damaging Het
Lrba G T 3: 86,267,457 (GRCm39) D1716Y possibly damaging Het
Ltf T A 9: 110,856,445 (GRCm39) probably benign Het
Map3k6 A G 4: 132,976,160 (GRCm39) T794A possibly damaging Het
Mcm8 A G 2: 132,665,174 (GRCm39) T217A probably damaging Het
Meaf6 A G 4: 124,996,713 (GRCm39) E141G probably damaging Het
Mmp13 A G 9: 7,278,880 (GRCm39) T324A possibly damaging Het
Mplkipl1 C T 19: 61,164,364 (GRCm39) G24R unknown Het
Msl2 T G 9: 100,979,350 (GRCm39) F575V probably benign Het
Ncoa4-ps C T 12: 119,225,529 (GRCm39) noncoding transcript Het
Nlrp2 A T 7: 5,331,950 (GRCm39) W149R possibly damaging Het
Ntng1 C A 3: 110,042,727 (GRCm39) C33F probably damaging Het
Nxn A G 11: 76,152,418 (GRCm39) Y359H probably benign Het
Olfml2a A C 2: 38,850,033 (GRCm39) D583A probably damaging Het
Or12j5 A C 7: 140,083,583 (GRCm39) L263R probably damaging Het
Or1e32 A T 11: 73,705,547 (GRCm39) Y120* probably null Het
Or2t48 A G 11: 58,420,422 (GRCm39) I130T probably damaging Het
Or4b1b A T 2: 90,112,547 (GRCm39) I124N probably damaging Het
Or51ac3 A T 7: 103,213,752 (GRCm39) S245T probably damaging Het
Pcdha4 T C 18: 37,086,251 (GRCm39) S145P probably damaging Het
Pcsk2 A T 2: 143,643,099 (GRCm39) K459* probably null Het
Pirb C T 7: 3,720,602 (GRCm39) G299S probably benign Het
Plch2 A G 4: 155,075,570 (GRCm39) F653S probably damaging Het
Plpp3 T C 4: 105,088,167 (GRCm39) I296T probably benign Het
Polr2b A G 5: 77,490,398 (GRCm39) E846G probably benign Het
Ptpro A T 6: 137,419,708 (GRCm39) N157Y probably damaging Het
Ralgapa1 A G 12: 55,723,222 (GRCm39) L1815P probably damaging Het
Sap18 A G 14: 58,036,020 (GRCm39) N69D probably damaging Het
Sncg C A 14: 34,095,284 (GRCm39) V74F probably damaging Het
Spata31e2 T C 1: 26,724,923 (GRCm39) K86E possibly damaging Het
Spmip4 A C 6: 50,572,836 (GRCm39) S26A possibly damaging Het
Tmem186 A T 16: 8,453,681 (GRCm39) Y193* probably null Het
Trrap A G 5: 144,737,758 (GRCm39) S1045G probably benign Het
Tti2 T G 8: 31,640,998 (GRCm39) S41A probably benign Het
Unc13c T C 9: 73,838,568 (GRCm39) E761G probably damaging Het
Vamp2 T A 11: 68,980,637 (GRCm39) D68E probably benign Het
Vmn1r200 A T 13: 22,579,265 (GRCm39) M14L probably benign Het
Vps35 T A 8: 86,000,186 (GRCm39) D480V possibly damaging Het
Zfp462 T C 4: 55,012,213 (GRCm39) L1393P probably damaging Het
Zfp512 G A 5: 31,630,158 (GRCm39) M274I probably benign Het
Znfx1 C G 2: 166,886,151 (GRCm39) G803A possibly damaging Het
Other mutations in Agbl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Agbl5 APN 5 31,050,578 (GRCm39) missense probably benign 0.00
sausage UTSW 5 31,051,702 (GRCm39) nonsense probably null
R0355:Agbl5 UTSW 5 31,049,335 (GRCm39) critical splice donor site probably null
R0575:Agbl5 UTSW 5 31,051,798 (GRCm39) missense probably damaging 1.00
R1694:Agbl5 UTSW 5 31,050,726 (GRCm39) missense probably damaging 1.00
R1709:Agbl5 UTSW 5 31,063,585 (GRCm39) missense probably damaging 1.00
R1829:Agbl5 UTSW 5 31,060,408 (GRCm39) missense possibly damaging 0.66
R2434:Agbl5 UTSW 5 31,051,357 (GRCm39) missense probably damaging 0.97
R3418:Agbl5 UTSW 5 31,062,067 (GRCm39) missense probably damaging 1.00
R4828:Agbl5 UTSW 5 31,048,059 (GRCm39) missense probably damaging 1.00
R4830:Agbl5 UTSW 5 31,048,059 (GRCm39) missense probably damaging 1.00
R5017:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5018:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5036:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5038:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5052:Agbl5 UTSW 5 31,048,558 (GRCm39) missense possibly damaging 0.76
R5071:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5073:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5074:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5081:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5083:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5103:Agbl5 UTSW 5 31,051,345 (GRCm39) missense probably damaging 1.00
R5107:Agbl5 UTSW 5 31,049,822 (GRCm39) missense probably damaging 1.00
R5130:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5395:Agbl5 UTSW 5 31,047,682 (GRCm39) missense probably damaging 1.00
R5522:Agbl5 UTSW 5 31,051,247 (GRCm39) splice site probably null
R5524:Agbl5 UTSW 5 31,051,247 (GRCm39) splice site probably null
R5526:Agbl5 UTSW 5 31,051,247 (GRCm39) splice site probably null
R5657:Agbl5 UTSW 5 31,051,390 (GRCm39) missense probably damaging 1.00
R5790:Agbl5 UTSW 5 31,051,702 (GRCm39) nonsense probably null
R6301:Agbl5 UTSW 5 31,049,177 (GRCm39) missense probably damaging 1.00
R6891:Agbl5 UTSW 5 31,052,522 (GRCm39) missense probably damaging 1.00
R6919:Agbl5 UTSW 5 31,062,061 (GRCm39) missense probably benign 0.13
R7388:Agbl5 UTSW 5 31,060,583 (GRCm39) nonsense probably null
R7392:Agbl5 UTSW 5 31,048,115 (GRCm39) critical splice donor site probably null
R7410:Agbl5 UTSW 5 31,048,032 (GRCm39) missense possibly damaging 0.94
R7452:Agbl5 UTSW 5 31,050,735 (GRCm39) missense probably damaging 1.00
R8312:Agbl5 UTSW 5 31,051,850 (GRCm39) missense probably damaging 1.00
R8901:Agbl5 UTSW 5 31,048,435 (GRCm39) missense possibly damaging 0.58
RF007:Agbl5 UTSW 5 31,060,589 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CGAGCTAGATCCTCATCCACAG -3'
(R):5'- AAGCTCTTTCTCCCCAGCAATG -3'

Sequencing Primer
(F):5'- GATCCTCATCCACAGGCGGAC -3'
(R):5'- GCTCCCAGACTGGCTTAC -3'
Posted On 2016-03-01