Incidental Mutation 'R4829:Spg11'
ID372643
Institutional Source Beutler Lab
Gene Symbol Spg11
Ensembl Gene ENSMUSG00000033396
Gene NameSPG11, spatacsin vesicle trafficking associated
SynonymsC530005A01Rik, 6030465E24Rik
MMRRC Submission 042445-MU
Accession Numbers

Genbank: NM_145531

Is this an essential gene? Possibly non essential (E-score: 0.471) question?
Stock #R4829 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location122053520-122118386 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 122108455 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 339 (N339K)
Ref Sequence ENSEMBL: ENSMUSP00000037543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036450]
Predicted Effect probably benign
Transcript: ENSMUST00000036450
AA Change: N339K

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000037543
Gene: ENSMUSG00000033396
AA Change: N339K

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 254 276 N/A INTRINSIC
low complexity region 945 958 N/A INTRINSIC
low complexity region 1250 1264 N/A INTRINSIC
low complexity region 1305 1313 N/A INTRINSIC
low complexity region 1673 1684 N/A INTRINSIC
low complexity region 1772 1784 N/A INTRINSIC
Pfam:Spatacsin_C 2082 2374 1.1e-105 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135847
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency 98% (109/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a potential transmembrane protein that is phosphorylated upon DNA damage. Defects in this gene are a cause of spastic paraplegia type 11 (SPG11). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a knock-out allele develop a progressive spastic and ataxic gait disorder and show loss of cortical motoneurons and Purkinje cells, a reduced number of lysosomes available for fusion with autophagosomes in degenerating neurons, and accumulation of autolysosome-derived material. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,019 V1323A probably damaging Het
1700029J07Rik T C 8: 45,967,915 I159V probably damaging Het
1700061G19Rik A G 17: 56,883,500 probably null Het
Abcb1a T C 5: 8,723,214 L814P probably damaging Het
Acat1 C A 9: 53,591,456 G191V probably damaging Het
Adamts20 A T 15: 94,326,396 D1184E probably benign Het
Adssl1 T C 12: 112,634,713 L283P probably damaging Het
Arid4a A G 12: 71,023,498 probably null Het
Arid4b T A 13: 14,184,438 D599E probably benign Het
AW146154 T C 7: 41,480,633 K353R possibly damaging Het
Axdnd1 G T 1: 156,376,646 R547S possibly damaging Het
BC067074 A G 13: 113,368,162 I1942V probably benign Het
BC147527 G A 13: 120,308,390 C82Y possibly damaging Het
Bcat1 A T 6: 145,015,475 F134Y probably damaging Het
Camk2d C A 3: 126,779,997 probably benign Het
Catsperg2 T G 7: 29,701,125 K268T probably damaging Het
Ccar1 A C 10: 62,745,335 F1103L unknown Het
Ccdc141 T A 2: 77,074,916 E395D probably damaging Het
Cdc37l1 A G 19: 28,990,583 T16A probably benign Het
Cdca2 T A 14: 67,693,753 probably null Het
Cntn5 T G 9: 9,976,283 K219Q probably damaging Het
Col23a1 C A 11: 51,557,586 A202E unknown Het
Csmd1 G A 8: 16,127,296 L1318F probably damaging Het
Csnk1g3 C T 18: 53,895,823 A16V possibly damaging Het
Dab2 A G 15: 6,424,681 D224G probably damaging Het
Ddr1 A T 17: 35,685,113 C625S probably damaging Het
Dennd4a T C 9: 64,889,056 V788A probably damaging Het
Dgcr2 T C 16: 17,842,753 E402G possibly damaging Het
Dhcr7 T G 7: 143,837,917 I81S probably damaging Het
Exd1 C T 2: 119,520,326 A485T probably benign Het
Fat1 C T 8: 45,036,162 T3467I probably damaging Het
Fblim1 T C 4: 141,584,709 E235G probably damaging Het
Fbxo38 T A 18: 62,518,591 M548L probably benign Het
Fstl5 T C 3: 76,322,182 Y97H probably damaging Het
Glb1l A T 1: 75,200,350 S481T probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gp2 A T 7: 119,457,184 V22E possibly damaging Het
Grin1 A G 2: 25,318,724 S55P possibly damaging Het
Herc2 A G 7: 56,106,492 D760G probably benign Het
Hpn A G 7: 31,098,875 probably benign Het
Hsf2 T C 10: 57,496,170 V73A probably damaging Het
Ighv1-42 T C 12: 114,937,168 Y80C probably benign Het
Ighv1-64 T C 12: 115,507,726 K57R probably benign Het
Klc1 T C 12: 111,795,603 I569T probably damaging Het
Klra3 T G 6: 130,323,616 K263N probably benign Het
Lrcol1 C A 5: 110,354,527 H90N probably benign Het
Mamdc4 T C 2: 25,565,356 E921G possibly damaging Het
Mark1 G A 1: 184,905,527 R622W possibly damaging Het
Mdga1 A G 17: 29,846,369 S696P possibly damaging Het
Mmp1b C T 9: 7,370,729 probably null Het
Mtnr1a T C 8: 45,085,615 probably benign Het
Myo5a T C 9: 75,136,407 I226T probably damaging Het
Ncoa6 G T 2: 155,415,227 P799T probably damaging Het
Npc1l1 C T 11: 6,214,010 probably null Het
Nxph3 T C 11: 95,511,495 E31G probably benign Het
Obscn T C 11: 59,054,246 I4649V probably null Het
Olfr1100 G A 2: 86,978,574 S74L probably damaging Het
Olfr875 G T 9: 37,772,947 C96F probably damaging Het
Olfr955 A T 9: 39,470,367 Y120N probably damaging Het
Olfr960 A T 9: 39,623,438 H103L probably damaging Het
P3h3 G A 6: 124,841,638 probably benign Het
Pcnx2 A T 8: 125,861,058 probably null Het
Pirb C T 7: 3,717,603 G299S probably benign Het
Pla2g4d A G 2: 120,266,743 S792P probably damaging Het
Plppr4 A T 3: 117,335,591 L76M possibly damaging Het
Ppp2r3a A T 9: 101,212,510 S205T possibly damaging Het
Prkdc G A 16: 15,702,075 D1126N possibly damaging Het
Prrt4 G A 6: 29,177,182 S196L probably benign Het
Ptpn21 A C 12: 98,689,296 S471A probably damaging Het
Ptprk C A 10: 28,580,484 S9* probably null Het
Rassf4 A T 6: 116,645,142 I163K possibly damaging Het
Rgs22 C A 15: 36,103,888 R142S probably damaging Het
Rit2 C A 18: 31,212,673 L73F probably damaging Het
Rrbp1 A C 2: 143,989,687 S187A probably benign Het
Rspo2 A T 15: 43,093,187 Y83* probably null Het
Scn5a C T 9: 119,534,707 V456M probably benign Het
Scn9a T A 2: 66,551,713 H290L probably benign Het
Smarca4 T C 9: 21,639,327 I452T probably damaging Het
Smc2 T A 4: 52,449,612 I198K probably damaging Het
Smim14 G A 5: 65,460,603 probably benign Het
Spta1 A G 1: 174,237,927 E2014G probably benign Het
Stk4 T C 2: 164,099,827 probably null Het
Sypl C T 12: 32,967,646 T121M probably damaging Het
Tas2r120 T A 6: 132,657,368 F138I probably benign Het
Tet2 A C 3: 133,476,620 C1194W possibly damaging Het
Tex29 T C 8: 11,855,668 probably benign Het
Tnfrsf22 T A 7: 143,643,330 T91S possibly damaging Het
Tnik A T 3: 28,539,541 probably benign Het
Tnr A T 1: 159,858,404 I402F probably benign Het
Unc93b1 A T 19: 3,944,293 S475C probably damaging Het
Utrn T A 10: 12,663,461 E1937D probably benign Het
Vmn1r227 A T 17: 20,735,665 noncoding transcript Het
Vmn2r101 G A 17: 19,611,967 V742I probably benign Het
Vmn2r81 T C 10: 79,247,801 L3P possibly damaging Het
Zfp882 T G 8: 71,914,389 H353Q probably damaging Het
Other mutations in Spg11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Spg11 APN 2 122065560 missense probably damaging 0.96
IGL00495:Spg11 APN 2 122094456 critical splice donor site probably null
IGL00757:Spg11 APN 2 122070959 missense probably benign 0.05
IGL01304:Spg11 APN 2 122072290 missense probably damaging 1.00
IGL01355:Spg11 APN 2 122113156 missense probably benign
IGL01626:Spg11 APN 2 122060971 missense probably damaging 0.98
IGL01739:Spg11 APN 2 122114671 missense probably damaging 1.00
IGL01835:Spg11 APN 2 122088224 missense probably benign 0.36
IGL02129:Spg11 APN 2 122095686 missense probably damaging 0.99
IGL02178:Spg11 APN 2 122097302 missense probably damaging 1.00
IGL02199:Spg11 APN 2 122059553 missense probably damaging 1.00
IGL02212:Spg11 APN 2 122108157 missense probably benign 0.31
IGL02605:Spg11 APN 2 122092260 missense probably benign 0.00
IGL02635:Spg11 APN 2 122113068 missense possibly damaging 0.52
IGL02743:Spg11 APN 2 122059507 missense probably damaging 0.97
IGL02822:Spg11 APN 2 122074534 missense probably damaging 0.99
IGL02992:Spg11 APN 2 122058398 missense probably damaging 1.00
IGL03010:Spg11 APN 2 122088320 missense probably damaging 0.96
3-1:Spg11 UTSW 2 122086890 missense probably damaging 0.98
PIT4354001:Spg11 UTSW 2 122088185 missense probably damaging 0.98
R0131:Spg11 UTSW 2 122070968 missense probably damaging 1.00
R0206:Spg11 UTSW 2 122055696 critical splice donor site probably null
R0208:Spg11 UTSW 2 122055696 critical splice donor site probably null
R0302:Spg11 UTSW 2 122092187 missense possibly damaging 0.90
R0347:Spg11 UTSW 2 122097369 missense probably damaging 0.99
R0357:Spg11 UTSW 2 122066232 splice site probably benign
R0372:Spg11 UTSW 2 122059447 frame shift probably null
R0715:Spg11 UTSW 2 122084983 missense probably benign 0.03
R0927:Spg11 UTSW 2 122094487 missense probably damaging 0.99
R1163:Spg11 UTSW 2 122070941 missense probably damaging 1.00
R1534:Spg11 UTSW 2 122092325 missense probably damaging 1.00
R1555:Spg11 UTSW 2 122097377 missense probably damaging 0.99
R1569:Spg11 UTSW 2 122101706 missense probably damaging 0.99
R1840:Spg11 UTSW 2 122101756 missense probably damaging 1.00
R1929:Spg11 UTSW 2 122060207 missense probably damaging 1.00
R2265:Spg11 UTSW 2 122108307 missense possibly damaging 0.48
R2303:Spg11 UTSW 2 122068837 missense probably damaging 0.99
R2510:Spg11 UTSW 2 122075310 missense probably benign 0.03
R2760:Spg11 UTSW 2 122097359 missense probably damaging 0.99
R2918:Spg11 UTSW 2 122075301 missense probably damaging 0.99
R3195:Spg11 UTSW 2 122083398 critical splice donor site probably null
R3423:Spg11 UTSW 2 122071053 missense probably benign 0.00
R4353:Spg11 UTSW 2 122113194 missense possibly damaging 0.92
R4407:Spg11 UTSW 2 122075332 missense probably benign 0.00
R4644:Spg11 UTSW 2 122061029 missense probably benign 0.03
R4663:Spg11 UTSW 2 122098099 critical splice donor site probably null
R4684:Spg11 UTSW 2 122065076 missense probably damaging 1.00
R4771:Spg11 UTSW 2 122065482 nonsense probably null
R4810:Spg11 UTSW 2 122059796 missense probably damaging 1.00
R5089:Spg11 UTSW 2 122114717 nonsense probably null
R5362:Spg11 UTSW 2 122061000 missense probably damaging 0.99
R5684:Spg11 UTSW 2 122093503 missense probably damaging 1.00
R5899:Spg11 UTSW 2 122098199 missense possibly damaging 0.67
R5923:Spg11 UTSW 2 122093478 missense probably damaging 0.98
R6052:Spg11 UTSW 2 122097356 missense probably damaging 0.99
R6111:Spg11 UTSW 2 122093482 missense probably damaging 0.98
R6174:Spg11 UTSW 2 122086805 intron probably null
R6226:Spg11 UTSW 2 122088262 missense possibly damaging 0.69
R6336:Spg11 UTSW 2 122112959 unclassified probably null
R6480:Spg11 UTSW 2 122092305 missense probably benign 0.03
R6494:Spg11 UTSW 2 122113225 missense probably damaging 0.98
R6582:Spg11 UTSW 2 122092292 missense probably damaging 0.99
R6714:Spg11 UTSW 2 122095731 missense probably damaging 0.99
R6791:Spg11 UTSW 2 122093443 missense probably damaging 0.99
R6836:Spg11 UTSW 2 122059535 missense probably damaging 1.00
R6928:Spg11 UTSW 2 122069904 missense probably benign 0.37
R7229:Spg11 UTSW 2 122108104 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GATCACTGCTCTTCACGTGC -3'
(R):5'- CAAACACTCACTTTTAGGGTCTCC -3'

Sequencing Primer
(F):5'- CACGTGCTCCTTCTGAGG -3'
(R):5'- TGTTTGTTGACAAGGTCTTACTATG -3'
Posted On2016-03-01