Incidental Mutation 'R4829:Tnik'
ID372647
Institutional Source Beutler Lab
Gene Symbol Tnik
Ensembl Gene ENSMUSG00000027692
Gene NameTRAF2 and NCK interacting kinase
SynonymsC630040K21Rik, 1500031A17Rik, 4831440I19Rik, C530008O15Rik
MMRRC Submission 042445-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4829 (G1)
Quality Score150
Status Validated
Chromosome3
Chromosomal Location28263214-28675858 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 28539541 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159236] [ENSMUST00000159308] [ENSMUST00000159680] [ENSMUST00000160307] [ENSMUST00000160518] [ENSMUST00000160934] [ENSMUST00000161964] [ENSMUST00000162485] [ENSMUST00000162777]
Predicted Effect probably benign
Transcript: ENSMUST00000159236
SMART Domains Protein: ENSMUSP00000124681
Gene: ENSMUSG00000027692

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
low complexity region 793 812 N/A INTRINSIC
low complexity region 951 958 N/A INTRINSIC
CNH 1005 1303 1.92e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159308
SMART Domains Protein: ENSMUSP00000125466
Gene: ENSMUSG00000027692

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 636 671 N/A INTRINSIC
low complexity region 746 765 N/A INTRINSIC
low complexity region 904 911 N/A INTRINSIC
CNH 958 1256 1.92e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159680
SMART Domains Protein: ENSMUSP00000124876
Gene: ENSMUSG00000027692

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 720 755 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 980 987 N/A INTRINSIC
CNH 1034 1332 1.92e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160307
SMART Domains Protein: ENSMUSP00000125081
Gene: ENSMUSG00000027692

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 720 755 N/A INTRINSIC
low complexity region 830 849 N/A INTRINSIC
low complexity region 988 995 N/A INTRINSIC
CNH 1042 1340 1.92e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160518
SMART Domains Protein: ENSMUSP00000124011
Gene: ENSMUSG00000027692

DomainStartEndE-ValueType
S_TKc 25 289 5.9e-99 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
low complexity region 801 820 N/A INTRINSIC
low complexity region 959 966 N/A INTRINSIC
CNH 1013 1311 9.3e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160934
SMART Domains Protein: ENSMUSP00000123859
Gene: ENSMUSG00000027692

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 25 212 2.2e-37 PFAM
Pfam:Pkinase 25 219 5.9e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161423
Predicted Effect probably benign
Transcript: ENSMUST00000161964
SMART Domains Protein: ENSMUSP00000125411
Gene: ENSMUSG00000027692

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 636 671 N/A INTRINSIC
low complexity region 738 757 N/A INTRINSIC
low complexity region 896 903 N/A INTRINSIC
CNH 950 1248 1.92e-117 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162037
Predicted Effect probably benign
Transcript: ENSMUST00000162485
SMART Domains Protein: ENSMUSP00000124387
Gene: ENSMUSG00000027692

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 665 700 N/A INTRINSIC
low complexity region 775 794 N/A INTRINSIC
low complexity region 933 940 N/A INTRINSIC
CNH 987 1285 1.92e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162777
SMART Domains Protein: ENSMUSP00000124726
Gene: ENSMUSG00000027692

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 665 700 N/A INTRINSIC
low complexity region 767 786 N/A INTRINSIC
low complexity region 925 932 N/A INTRINSIC
CNH 979 1277 1.92e-117 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193721
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency 98% (109/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Germinal center kinases (GCKs), such as TNIK, are characterized by an N-terminal kinase domain and a C-terminal GCK domain that serves a regulatory function (Fu et al., 1999 [PubMed 10521462]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired postsynaptic signaling and cognitive function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,019 V1323A probably damaging Het
1700029J07Rik T C 8: 45,967,915 I159V probably damaging Het
1700061G19Rik A G 17: 56,883,500 probably null Het
Abcb1a T C 5: 8,723,214 L814P probably damaging Het
Acat1 C A 9: 53,591,456 G191V probably damaging Het
Adamts20 A T 15: 94,326,396 D1184E probably benign Het
Adssl1 T C 12: 112,634,713 L283P probably damaging Het
Arid4a A G 12: 71,023,498 probably null Het
Arid4b T A 13: 14,184,438 D599E probably benign Het
AW146154 T C 7: 41,480,633 K353R possibly damaging Het
Axdnd1 G T 1: 156,376,646 R547S possibly damaging Het
BC067074 A G 13: 113,368,162 I1942V probably benign Het
BC147527 G A 13: 120,308,390 C82Y possibly damaging Het
Bcat1 A T 6: 145,015,475 F134Y probably damaging Het
Camk2d C A 3: 126,779,997 probably benign Het
Catsperg2 T G 7: 29,701,125 K268T probably damaging Het
Ccar1 A C 10: 62,745,335 F1103L unknown Het
Ccdc141 T A 2: 77,074,916 E395D probably damaging Het
Cdc37l1 A G 19: 28,990,583 T16A probably benign Het
Cdca2 T A 14: 67,693,753 probably null Het
Cntn5 T G 9: 9,976,283 K219Q probably damaging Het
Col23a1 C A 11: 51,557,586 A202E unknown Het
Csmd1 G A 8: 16,127,296 L1318F probably damaging Het
Csnk1g3 C T 18: 53,895,823 A16V possibly damaging Het
Dab2 A G 15: 6,424,681 D224G probably damaging Het
Ddr1 A T 17: 35,685,113 C625S probably damaging Het
Dennd4a T C 9: 64,889,056 V788A probably damaging Het
Dgcr2 T C 16: 17,842,753 E402G possibly damaging Het
Dhcr7 T G 7: 143,837,917 I81S probably damaging Het
Exd1 C T 2: 119,520,326 A485T probably benign Het
Fat1 C T 8: 45,036,162 T3467I probably damaging Het
Fblim1 T C 4: 141,584,709 E235G probably damaging Het
Fbxo38 T A 18: 62,518,591 M548L probably benign Het
Fstl5 T C 3: 76,322,182 Y97H probably damaging Het
Glb1l A T 1: 75,200,350 S481T probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gp2 A T 7: 119,457,184 V22E possibly damaging Het
Grin1 A G 2: 25,318,724 S55P possibly damaging Het
Herc2 A G 7: 56,106,492 D760G probably benign Het
Hpn A G 7: 31,098,875 probably benign Het
Hsf2 T C 10: 57,496,170 V73A probably damaging Het
Ighv1-42 T C 12: 114,937,168 Y80C probably benign Het
Ighv1-64 T C 12: 115,507,726 K57R probably benign Het
Klc1 T C 12: 111,795,603 I569T probably damaging Het
Klra3 T G 6: 130,323,616 K263N probably benign Het
Lrcol1 C A 5: 110,354,527 H90N probably benign Het
Mamdc4 T C 2: 25,565,356 E921G possibly damaging Het
Mark1 G A 1: 184,905,527 R622W possibly damaging Het
Mdga1 A G 17: 29,846,369 S696P possibly damaging Het
Mmp1b C T 9: 7,370,729 probably null Het
Mtnr1a T C 8: 45,085,615 probably benign Het
Myo5a T C 9: 75,136,407 I226T probably damaging Het
Ncoa6 G T 2: 155,415,227 P799T probably damaging Het
Npc1l1 C T 11: 6,214,010 probably null Het
Nxph3 T C 11: 95,511,495 E31G probably benign Het
Obscn T C 11: 59,054,246 I4649V probably null Het
Olfr1100 G A 2: 86,978,574 S74L probably damaging Het
Olfr875 G T 9: 37,772,947 C96F probably damaging Het
Olfr955 A T 9: 39,470,367 Y120N probably damaging Het
Olfr960 A T 9: 39,623,438 H103L probably damaging Het
P3h3 G A 6: 124,841,638 probably benign Het
Pcnx2 A T 8: 125,861,058 probably null Het
Pirb C T 7: 3,717,603 G299S probably benign Het
Pla2g4d A G 2: 120,266,743 S792P probably damaging Het
Plppr4 A T 3: 117,335,591 L76M possibly damaging Het
Ppp2r3a A T 9: 101,212,510 S205T possibly damaging Het
Prkdc G A 16: 15,702,075 D1126N possibly damaging Het
Prrt4 G A 6: 29,177,182 S196L probably benign Het
Ptpn21 A C 12: 98,689,296 S471A probably damaging Het
Ptprk C A 10: 28,580,484 S9* probably null Het
Rassf4 A T 6: 116,645,142 I163K possibly damaging Het
Rgs22 C A 15: 36,103,888 R142S probably damaging Het
Rit2 C A 18: 31,212,673 L73F probably damaging Het
Rrbp1 A C 2: 143,989,687 S187A probably benign Het
Rspo2 A T 15: 43,093,187 Y83* probably null Het
Scn5a C T 9: 119,534,707 V456M probably benign Het
Scn9a T A 2: 66,551,713 H290L probably benign Het
Smarca4 T C 9: 21,639,327 I452T probably damaging Het
Smc2 T A 4: 52,449,612 I198K probably damaging Het
Smim14 G A 5: 65,460,603 probably benign Het
Spg11 A C 2: 122,108,455 N339K probably benign Het
Spta1 A G 1: 174,237,927 E2014G probably benign Het
Stk4 T C 2: 164,099,827 probably null Het
Sypl C T 12: 32,967,646 T121M probably damaging Het
Tas2r120 T A 6: 132,657,368 F138I probably benign Het
Tet2 A C 3: 133,476,620 C1194W possibly damaging Het
Tex29 T C 8: 11,855,668 probably benign Het
Tnfrsf22 T A 7: 143,643,330 T91S possibly damaging Het
Tnr A T 1: 159,858,404 I402F probably benign Het
Unc93b1 A T 19: 3,944,293 S475C probably damaging Het
Utrn T A 10: 12,663,461 E1937D probably benign Het
Vmn1r227 A T 17: 20,735,665 noncoding transcript Het
Vmn2r101 G A 17: 19,611,967 V742I probably benign Het
Vmn2r81 T C 10: 79,247,801 L3P possibly damaging Het
Zfp882 T G 8: 71,914,389 H353Q probably damaging Het
Other mutations in Tnik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Tnik APN 3 28654218 missense probably damaging 1.00
IGL00726:Tnik APN 3 28532898 missense probably damaging 1.00
IGL01022:Tnik APN 3 28625228 splice site probably null
IGL01145:Tnik APN 3 28604167 intron probably benign
IGL01664:Tnik APN 3 28638479 missense probably damaging 1.00
IGL01843:Tnik APN 3 28570858 splice site probably null
IGL02378:Tnik APN 3 28638459 nonsense probably null
IGL02448:Tnik APN 3 28621077 missense probably null 0.01
IGL02756:Tnik APN 3 28542030 missense probably damaging 1.00
IGL03332:Tnik APN 3 28666155 missense probably damaging 1.00
Usher UTSW 3 28564097 missense possibly damaging 0.61
R0135:Tnik UTSW 3 28607245 missense possibly damaging 0.67
R0418:Tnik UTSW 3 28570880 nonsense probably null
R0540:Tnik UTSW 3 28650159 missense probably damaging 1.00
R0549:Tnik UTSW 3 28570920 missense possibly damaging 0.87
R0556:Tnik UTSW 3 28625218 missense possibly damaging 0.95
R0586:Tnik UTSW 3 28577361 splice site probably benign
R0607:Tnik UTSW 3 28650159 missense probably damaging 1.00
R0842:Tnik UTSW 3 28594086 missense possibly damaging 0.72
R1068:Tnik UTSW 3 28532975 missense probably damaging 1.00
R1171:Tnik UTSW 3 28532940 missense probably damaging 1.00
R1597:Tnik UTSW 3 28604269 missense probably damaging 1.00
R1638:Tnik UTSW 3 28665740 missense probably damaging 0.99
R1652:Tnik UTSW 3 28604293 missense probably benign 0.22
R1996:Tnik UTSW 3 28665680 missense probably damaging 1.00
R2333:Tnik UTSW 3 28532996 missense probably damaging 1.00
R2426:Tnik UTSW 3 28646681 missense probably damaging 1.00
R2509:Tnik UTSW 3 28667915 missense probably damaging 1.00
R3774:Tnik UTSW 3 28638419 missense probably damaging 0.98
R3775:Tnik UTSW 3 28638419 missense probably damaging 0.98
R4007:Tnik UTSW 3 28604281 missense probably damaging 1.00
R4119:Tnik UTSW 3 28666175 missense probably damaging 1.00
R4209:Tnik UTSW 3 28359065 splice site probably benign
R4441:Tnik UTSW 3 28564097 missense possibly damaging 0.61
R4611:Tnik UTSW 3 28542100 critical splice donor site probably null
R4714:Tnik UTSW 3 28594077 missense possibly damaging 0.53
R4772:Tnik UTSW 3 28607210 missense probably benign 0.09
R4839:Tnik UTSW 3 28596075 missense possibly damaging 0.86
R4898:Tnik UTSW 3 28650086 missense probably damaging 1.00
R5029:Tnik UTSW 3 28665844 splice site probably null
R5278:Tnik UTSW 3 28650060 missense probably damaging 1.00
R5307:Tnik UTSW 3 28541972 missense probably damaging 1.00
R5330:Tnik UTSW 3 28542018 missense probably damaging 1.00
R5375:Tnik UTSW 3 28594092 missense probably benign 0.02
R5459:Tnik UTSW 3 28661741 missense probably damaging 1.00
R5708:Tnik UTSW 3 28611971 critical splice donor site probably null
R5749:Tnik UTSW 3 28594092 missense probably benign 0.02
R5751:Tnik UTSW 3 28594092 missense probably benign 0.02
R5780:Tnik UTSW 3 28594092 missense probably benign 0.02
R5837:Tnik UTSW 3 28668053 unclassified probably benign
R5969:Tnik UTSW 3 28620948 missense probably damaging 1.00
R6244:Tnik UTSW 3 28650179 missense probably damaging 1.00
R6273:Tnik UTSW 3 28577500 missense possibly damaging 0.94
R6457:Tnik UTSW 3 28539448 missense probably damaging 1.00
R6464:Tnik UTSW 3 28611970 critical splice donor site probably null
R6473:Tnik UTSW 3 28263643 start codon destroyed probably null 0.93
R6737:Tnik UTSW 3 28596086 missense possibly damaging 0.72
R7049:Tnik UTSW 3 28661704 nonsense probably null
R7237:Tnik UTSW 3 28638419 missense probably damaging 0.98
R7267:Tnik UTSW 3 28646627 missense probably damaging 0.99
X0022:Tnik UTSW 3 28667951 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACAAGTATCTCTGGGTGAGTTG -3'
(R):5'- TGTAGGCTTCTAGTCACCACAC -3'

Sequencing Primer
(F):5'- TCAAAAGTGTGTTTCCATCTTCG -3'
(R):5'- TTTGGGGAAATGCCCCA -3'
Posted On2016-03-01