Incidental Mutation 'R4829:Smarca4'
ID372676
Institutional Source Beutler Lab
Gene Symbol Smarca4
Ensembl Gene ENSMUSG00000032187
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
SynonymsSNF2beta, SW1/SNF, b2b508.1Clo, Brg1, b2b692Clo
MMRRC Submission 042445-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4829 (G1)
Quality Score171
Status Validated
Chromosome9
Chromosomal Location21616169-21704230 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21639327 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 452 (I452T)
Ref Sequence ENSEMBL: ENSMUSP00000096547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034707] [ENSMUST00000098948] [ENSMUST00000174008]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034707
AA Change: I452T

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034707
Gene: ENSMUSG00000032187
AA Change: I452T

DomainStartEndE-ValueType
low complexity region 6 58 N/A INTRINSIC
low complexity region 130 153 N/A INTRINSIC
QLQ 170 206 3.98e-14 SMART
low complexity region 221 247 N/A INTRINSIC
low complexity region 252 289 N/A INTRINSIC
low complexity region 304 330 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
HSA 460 532 2e-27 SMART
coiled coil region 563 595 N/A INTRINSIC
BRK 612 656 5.17e-21 SMART
low complexity region 657 672 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
DEXDc 750 942 5.17e-38 SMART
Blast:DEXDc 953 985 7e-10 BLAST
low complexity region 1019 1034 N/A INTRINSIC
HELICc 1110 1194 7.27e-24 SMART
low complexity region 1252 1267 N/A INTRINSIC
SnAC 1288 1356 2.8e-29 SMART
low complexity region 1360 1385 N/A INTRINSIC
low complexity region 1388 1398 N/A INTRINSIC
BROMO 1422 1533 4.19e-42 SMART
low complexity region 1534 1557 N/A INTRINSIC
low complexity region 1578 1588 N/A INTRINSIC
low complexity region 1594 1614 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098948
AA Change: I452T

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000096547
Gene: ENSMUSG00000032187
AA Change: I452T

DomainStartEndE-ValueType
low complexity region 6 58 N/A INTRINSIC
low complexity region 130 153 N/A INTRINSIC
QLQ 170 206 3.98e-14 SMART
low complexity region 221 247 N/A INTRINSIC
low complexity region 252 289 N/A INTRINSIC
low complexity region 304 330 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
HSA 460 532 2e-27 SMART
coiled coil region 563 595 N/A INTRINSIC
BRK 612 656 5.17e-21 SMART
low complexity region 657 672 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
DEXDc 750 942 5.17e-38 SMART
Blast:DEXDc 953 985 7e-10 BLAST
low complexity region 1019 1034 N/A INTRINSIC
HELICc 1110 1194 7.27e-24 SMART
low complexity region 1252 1267 N/A INTRINSIC
SnAC 1288 1356 2.8e-29 SMART
low complexity region 1363 1388 N/A INTRINSIC
low complexity region 1391 1401 N/A INTRINSIC
BROMO 1425 1536 4.19e-42 SMART
low complexity region 1537 1560 N/A INTRINSIC
low complexity region 1581 1591 N/A INTRINSIC
low complexity region 1597 1617 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000172996
AA Change: I256T
SMART Domains Protein: ENSMUSP00000133535
Gene: ENSMUSG00000032187
AA Change: I256T

DomainStartEndE-ValueType
low complexity region 26 52 N/A INTRINSIC
low complexity region 57 94 N/A INTRINSIC
low complexity region 109 135 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
HSA 265 337 2e-27 SMART
coiled coil region 367 399 N/A INTRINSIC
BRK 417 461 5.17e-21 SMART
low complexity region 462 477 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
DEXDc 555 747 5.17e-38 SMART
Blast:DEXDc 758 790 6e-10 BLAST
low complexity region 824 839 N/A INTRINSIC
HELICc 915 999 7.27e-24 SMART
low complexity region 1088 1105 N/A INTRINSIC
SnAC 1126 1194 2.8e-29 SMART
low complexity region 1201 1226 N/A INTRINSIC
low complexity region 1229 1239 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000174008
AA Change: I452T

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133922
Gene: ENSMUSG00000032187
AA Change: I452T

DomainStartEndE-ValueType
low complexity region 6 58 N/A INTRINSIC
low complexity region 130 153 N/A INTRINSIC
QLQ 170 206 3.98e-14 SMART
low complexity region 221 247 N/A INTRINSIC
low complexity region 252 289 N/A INTRINSIC
low complexity region 304 330 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
HSA 460 532 2e-27 SMART
coiled coil region 563 595 N/A INTRINSIC
BRK 612 656 5.17e-21 SMART
low complexity region 657 672 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
DEXDc 750 942 5.17e-38 SMART
Blast:DEXDc 953 985 7e-10 BLAST
low complexity region 1019 1034 N/A INTRINSIC
HELICc 1110 1194 7.27e-24 SMART
low complexity region 1252 1267 N/A INTRINSIC
SnAC 1288 1356 2.8e-29 SMART
low complexity region 1360 1385 N/A INTRINSIC
low complexity region 1388 1398 N/A INTRINSIC
BROMO 1422 1532 1.36e-41 SMART
low complexity region 1533 1556 N/A INTRINSIC
low complexity region 1577 1587 N/A INTRINSIC
low complexity region 1593 1613 N/A INTRINSIC
Meta Mutation Damage Score 0.224 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency 98% (109/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins and is similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. In addition, this protein can bind BRCA1, as well as regulate the expression of the tumorigenic protein CD44. Mutations in this gene cause rhabdoid tumor predisposition syndrome type 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for a null allele die in utero before implantation. Embryos heterozygous for this null allele and an ENU-induced allele show impaired definitive erythropoiesis, anemia and lethality during organogenesis. Heterozygotes for a different null allele show cyanosis and cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,019 V1323A probably damaging Het
1700029J07Rik T C 8: 45,967,915 I159V probably damaging Het
1700061G19Rik A G 17: 56,883,500 probably null Het
Abcb1a T C 5: 8,723,214 L814P probably damaging Het
Acat1 C A 9: 53,591,456 G191V probably damaging Het
Adamts20 A T 15: 94,326,396 D1184E probably benign Het
Adssl1 T C 12: 112,634,713 L283P probably damaging Het
Arid4a A G 12: 71,023,498 probably null Het
Arid4b T A 13: 14,184,438 D599E probably benign Het
AW146154 T C 7: 41,480,633 K353R possibly damaging Het
Axdnd1 G T 1: 156,376,646 R547S possibly damaging Het
BC067074 A G 13: 113,368,162 I1942V probably benign Het
BC147527 G A 13: 120,308,390 C82Y possibly damaging Het
Bcat1 A T 6: 145,015,475 F134Y probably damaging Het
Camk2d C A 3: 126,779,997 probably benign Het
Catsperg2 T G 7: 29,701,125 K268T probably damaging Het
Ccar1 A C 10: 62,745,335 F1103L unknown Het
Ccdc141 T A 2: 77,074,916 E395D probably damaging Het
Cdc37l1 A G 19: 28,990,583 T16A probably benign Het
Cdca2 T A 14: 67,693,753 probably null Het
Cntn5 T G 9: 9,976,283 K219Q probably damaging Het
Col23a1 C A 11: 51,557,586 A202E unknown Het
Csmd1 G A 8: 16,127,296 L1318F probably damaging Het
Csnk1g3 C T 18: 53,895,823 A16V possibly damaging Het
Dab2 A G 15: 6,424,681 D224G probably damaging Het
Ddr1 A T 17: 35,685,113 C625S probably damaging Het
Dennd4a T C 9: 64,889,056 V788A probably damaging Het
Dgcr2 T C 16: 17,842,753 E402G possibly damaging Het
Dhcr7 T G 7: 143,837,917 I81S probably damaging Het
Exd1 C T 2: 119,520,326 A485T probably benign Het
Fat1 C T 8: 45,036,162 T3467I probably damaging Het
Fblim1 T C 4: 141,584,709 E235G probably damaging Het
Fbxo38 T A 18: 62,518,591 M548L probably benign Het
Fstl5 T C 3: 76,322,182 Y97H probably damaging Het
Glb1l A T 1: 75,200,350 S481T probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gp2 A T 7: 119,457,184 V22E possibly damaging Het
Grin1 A G 2: 25,318,724 S55P possibly damaging Het
Herc2 A G 7: 56,106,492 D760G probably benign Het
Hpn A G 7: 31,098,875 probably benign Het
Hsf2 T C 10: 57,496,170 V73A probably damaging Het
Ighv1-42 T C 12: 114,937,168 Y80C probably benign Het
Ighv1-64 T C 12: 115,507,726 K57R probably benign Het
Klc1 T C 12: 111,795,603 I569T probably damaging Het
Klra3 T G 6: 130,323,616 K263N probably benign Het
Lrcol1 C A 5: 110,354,527 H90N probably benign Het
Mamdc4 T C 2: 25,565,356 E921G possibly damaging Het
Mark1 G A 1: 184,905,527 R622W possibly damaging Het
Mdga1 A G 17: 29,846,369 S696P possibly damaging Het
Mmp1b C T 9: 7,370,729 probably null Het
Mtnr1a T C 8: 45,085,615 probably benign Het
Myo5a T C 9: 75,136,407 I226T probably damaging Het
Ncoa6 G T 2: 155,415,227 P799T probably damaging Het
Npc1l1 C T 11: 6,214,010 probably null Het
Nxph3 T C 11: 95,511,495 E31G probably benign Het
Obscn T C 11: 59,054,246 I4649V probably null Het
Olfr1100 G A 2: 86,978,574 S74L probably damaging Het
Olfr875 G T 9: 37,772,947 C96F probably damaging Het
Olfr955 A T 9: 39,470,367 Y120N probably damaging Het
Olfr960 A T 9: 39,623,438 H103L probably damaging Het
P3h3 G A 6: 124,841,638 probably benign Het
Pcnx2 A T 8: 125,861,058 probably null Het
Pirb C T 7: 3,717,603 G299S probably benign Het
Pla2g4d A G 2: 120,266,743 S792P probably damaging Het
Plppr4 A T 3: 117,335,591 L76M possibly damaging Het
Ppp2r3a A T 9: 101,212,510 S205T possibly damaging Het
Prkdc G A 16: 15,702,075 D1126N possibly damaging Het
Prrt4 G A 6: 29,177,182 S196L probably benign Het
Ptpn21 A C 12: 98,689,296 S471A probably damaging Het
Ptprk C A 10: 28,580,484 S9* probably null Het
Rassf4 A T 6: 116,645,142 I163K possibly damaging Het
Rgs22 C A 15: 36,103,888 R142S probably damaging Het
Rit2 C A 18: 31,212,673 L73F probably damaging Het
Rrbp1 A C 2: 143,989,687 S187A probably benign Het
Rspo2 A T 15: 43,093,187 Y83* probably null Het
Scn5a C T 9: 119,534,707 V456M probably benign Het
Scn9a T A 2: 66,551,713 H290L probably benign Het
Smc2 T A 4: 52,449,612 I198K probably damaging Het
Smim14 G A 5: 65,460,603 probably benign Het
Spg11 A C 2: 122,108,455 N339K probably benign Het
Spta1 A G 1: 174,237,927 E2014G probably benign Het
Stk4 T C 2: 164,099,827 probably null Het
Sypl C T 12: 32,967,646 T121M probably damaging Het
Tas2r120 T A 6: 132,657,368 F138I probably benign Het
Tet2 A C 3: 133,476,620 C1194W possibly damaging Het
Tex29 T C 8: 11,855,668 probably benign Het
Tnfrsf22 T A 7: 143,643,330 T91S possibly damaging Het
Tnik A T 3: 28,539,541 probably benign Het
Tnr A T 1: 159,858,404 I402F probably benign Het
Unc93b1 A T 19: 3,944,293 S475C probably damaging Het
Utrn T A 10: 12,663,461 E1937D probably benign Het
Vmn1r227 A T 17: 20,735,665 noncoding transcript Het
Vmn2r101 G A 17: 19,611,967 V742I probably benign Het
Vmn2r81 T C 10: 79,247,801 L3P possibly damaging Het
Zfp882 T G 8: 71,914,389 H353Q probably damaging Het
Other mutations in Smarca4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Smarca4 APN 9 21679073 missense probably benign 0.30
IGL01694:Smarca4 APN 9 21665870 missense probably damaging 1.00
IGL02147:Smarca4 APN 9 21635703 missense probably damaging 0.98
IGL02417:Smarca4 APN 9 21701090 missense probably damaging 1.00
IGL02421:Smarca4 APN 9 21639239 missense probably damaging 1.00
IGL02550:Smarca4 APN 9 21686122 missense probably benign 0.25
IGL02794:Smarca4 APN 9 21673342 splice site probably benign
IGL03030:Smarca4 APN 9 21635836 missense probably benign 0.14
IGL03037:Smarca4 APN 9 21632935 unclassified probably benign
IGL03069:Smarca4 APN 9 21635836 missense probably benign 0.14
IGL03355:Smarca4 APN 9 21635836 missense probably benign 0.14
R0123:Smarca4 UTSW 9 21637324 missense probably damaging 1.00
R0134:Smarca4 UTSW 9 21637324 missense probably damaging 1.00
R0230:Smarca4 UTSW 9 21700872 missense probably damaging 0.99
R0269:Smarca4 UTSW 9 21636201 missense probably benign 0.09
R0631:Smarca4 UTSW 9 21658984 splice site probably benign
R0665:Smarca4 UTSW 9 21700943 small deletion probably benign
R0726:Smarca4 UTSW 9 21700139 critical splice donor site probably null
R0801:Smarca4 UTSW 9 21642554 missense possibly damaging 0.81
R0918:Smarca4 UTSW 9 21636215 missense probably benign 0.16
R1411:Smarca4 UTSW 9 21658955 missense probably damaging 1.00
R1604:Smarca4 UTSW 9 21700943 small deletion probably benign
R1768:Smarca4 UTSW 9 21701183 missense possibly damaging 0.56
R2004:Smarca4 UTSW 9 21677480 missense probably damaging 1.00
R2031:Smarca4 UTSW 9 21686062 missense possibly damaging 0.68
R2211:Smarca4 UTSW 9 21686029 missense probably damaging 1.00
R2512:Smarca4 UTSW 9 21635698 missense possibly damaging 0.95
R2875:Smarca4 UTSW 9 21642580 missense possibly damaging 0.55
R3786:Smarca4 UTSW 9 21672059 missense possibly damaging 0.94
R5084:Smarca4 UTSW 9 21660763 missense probably damaging 1.00
R5222:Smarca4 UTSW 9 21655706 missense probably benign 0.01
R5785:Smarca4 UTSW 9 21686026 missense probably damaging 0.99
R5844:Smarca4 UTSW 9 21677942 intron probably benign
R5964:Smarca4 UTSW 9 21647430 missense probably benign 0.00
R6001:Smarca4 UTSW 9 21632909 unclassified probably benign
R6072:Smarca4 UTSW 9 21700121 missense probably damaging 1.00
R6254:Smarca4 UTSW 9 21699877 missense probably damaging 1.00
R6320:Smarca4 UTSW 9 21637375 missense probably damaging 1.00
R6353:Smarca4 UTSW 9 21679149 critical splice donor site probably null
R6461:Smarca4 UTSW 9 21679020 missense probably damaging 1.00
R6886:Smarca4 UTSW 9 21658831 missense probably damaging 1.00
R7098:Smarca4 UTSW 9 21634820 missense probably benign 0.10
R7253:Smarca4 UTSW 9 21658960 missense probably benign 0.01
R7307:Smarca4 UTSW 9 21638800 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGCATTCCAGGCAGTTTG -3'
(R):5'- GCCTGGTATGATCACTGCTC -3'

Sequencing Primer
(F):5'- TAGGATCATCTGCCCAGCATGTG -3'
(R):5'- TGGTATGATCACTGCTCTTCTTC -3'
Posted On2016-03-01